Incidental Mutation 'R7688:Slc5a8'
ID593220
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Namesolute carrier family 5 (iodide transporter), member 8
SynonymsSMCT
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88885992-88929515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88921699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 517 (Y517C)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
Predicted Effect probably damaging
Transcript: ENSMUST00000020255
AA Change: Y517C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: Y517C

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88908040 missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88919461 missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88921765 missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88906392 missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88892097 splice site probably benign
IGL01418:Slc5a8 APN 10 88905033 missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88919472 nonsense probably null
IGL02116:Slc5a8 APN 10 88919500 missense probably benign
IGL03109:Slc5a8 APN 10 88906416 splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88886503 missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88886590 missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88886558 missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88918442 missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88925786 critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88919464 missense probably benign
R1769:Slc5a8 UTSW 10 88919466 nonsense probably null
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88902463 missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88911413 missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88925787 critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88892024 missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88904912 splice site probably null
R4998:Slc5a8 UTSW 10 88908057 critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88909654 missense probably benign 0.07
R5068:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5069:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88926215 missense probably benign
R5141:Slc5a8 UTSW 10 88919560 critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88906347 missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88905054 missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88919502 missense probably benign
R7255:Slc5a8 UTSW 10 88909631 missense probably damaging 1.00
R7526:Slc5a8 UTSW 10 88902491 missense probably damaging 1.00
R7604:Slc5a8 UTSW 10 88904960 missense possibly damaging 0.78
R7869:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
R8219:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
Z1177:Slc5a8 UTSW 10 88909613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACAGTTCGAGATCAGCG -3'
(R):5'- GCTGAACTTTATCTTAGAGCAACC -3'

Sequencing Primer
(F):5'- CAACAGTTCGAGATCAGCGTCATTG -3'
(R):5'- ACATAAGAGTGGTTATGTACCTGGCC -3'
Posted On2019-11-12