Incidental Mutation 'R7688:Kctd1'
ID593226
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Namepotassium channel tetramerisation domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location14968685-15151446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 14974198 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 737 (T737P)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
Predicted Effect probably benign
Transcript: ENSMUST00000025992
AA Change: T141P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: T141P

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168989
AA Change: T737P

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: T737P

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15062690 missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01404:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15062637 missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15062880 missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 14969610 missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 14973979 critical splice donor site probably null
R0128:Kctd1 UTSW 18 14974180 missense probably benign 0.00
R0598:Kctd1 UTSW 18 15007765 missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15062597 missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15062460 missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 14969560 missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15063206 intron probably benign
R1779:Kctd1 UTSW 18 15061782 missense probably benign 0.01
R2083:Kctd1 UTSW 18 14974055 missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15062211 missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 14974086 missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15007700 missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15063227 intron probably benign
R4884:Kctd1 UTSW 18 14974254 missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15062523 missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15062765 missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15062265 missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15063516 intron probably benign
R5893:Kctd1 UTSW 18 14969688 missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 14969631 nonsense probably null
R6767:Kctd1 UTSW 18 15062175 missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 14986344 missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 14973988 missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15062643 missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15062412 missense possibly damaging 0.95
Z1176:Kctd1 UTSW 18 15063125 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGACATGTGTTGAGTCGTGAT -3'
(R):5'- ATCAGCTTCTTTTGCAATATAACTCT -3'

Sequencing Primer
(F):5'- GTGATTCCAGCCTGCATTGAC -3'
(R):5'- AGCTGGGCTACCTAGTAAGATCCTC -3'
Posted On2019-11-12