Incidental Mutation 'R0240:Col12a1'
ID 59323
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Name collagen, type XII, alpha 1
Synonyms
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R0240 (G1)
Quality Score 84
Status Validated
Chromosome 9
Chromosomal Location 79506273-79626113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79559315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1858 (S1858T)
Ref Sequence ENSEMBL: ENSMUSP00000071662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071750
AA Change: S1858T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: S1858T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121227
AA Change: S1858T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: S1858T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Dpy19l2 G T 9: 24,569,876 (GRCm39) A359D probably damaging Het
Ece1 T A 4: 137,676,746 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kcnma1 G A 14: 23,544,647 (GRCm39) T505I probably damaging Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lama3 A T 18: 12,672,880 (GRCm39) probably null Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Plce1 A C 19: 38,717,330 (GRCm39) K1373T probably damaging Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79,588,819 (GRCm39) missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79,560,614 (GRCm39) missense probably benign 0.27
IGL00465:Col12a1 APN 9 79,604,863 (GRCm39) missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79,558,759 (GRCm39) missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79,554,934 (GRCm39) missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79,599,508 (GRCm39) missense probably benign 0.05
IGL01015:Col12a1 APN 9 79,541,023 (GRCm39) missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79,611,129 (GRCm39) missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79,585,335 (GRCm39) missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79,551,208 (GRCm39) missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79,564,648 (GRCm39) missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79,508,451 (GRCm39) makesense probably null
IGL01878:Col12a1 APN 9 79,557,257 (GRCm39) missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79,557,299 (GRCm39) missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79,599,654 (GRCm39) missense probably benign 0.06
IGL02123:Col12a1 APN 9 79,569,740 (GRCm39) critical splice donor site probably null
IGL02312:Col12a1 APN 9 79,588,797 (GRCm39) missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79,523,303 (GRCm39) critical splice donor site probably null
IGL02328:Col12a1 APN 9 79,589,348 (GRCm39) missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79,557,178 (GRCm39) splice site probably null
IGL02355:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02362:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02396:Col12a1 APN 9 79,569,865 (GRCm39) missense probably benign
IGL02449:Col12a1 APN 9 79,548,751 (GRCm39) missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79,606,623 (GRCm39) missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79,521,141 (GRCm39) unclassified probably benign
IGL02801:Col12a1 APN 9 79,515,696 (GRCm39) splice site probably null
IGL03001:Col12a1 APN 9 79,540,955 (GRCm39) missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79,548,833 (GRCm39) missense probably benign 0.40
IGL03090:Col12a1 APN 9 79,585,652 (GRCm39) missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79,588,719 (GRCm39) missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79,606,765 (GRCm39) missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79,585,665 (GRCm39) splice site probably null
IGL03348:Col12a1 APN 9 79,600,712 (GRCm39) missense possibly damaging 0.88
airship UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
dirigible UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
Feast UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
hardly UTSW 9 79,607,632 (GRCm39) nonsense probably null
hearty UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
Hefty UTSW 9 79,569,736 (GRCm39) splice site probably benign
P0045:Col12a1 UTSW 9 79,554,893 (GRCm39) missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79,558,662 (GRCm39) critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79,585,387 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0276:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R0309:Col12a1 UTSW 9 79,507,293 (GRCm39) splice site probably null
R0336:Col12a1 UTSW 9 79,609,627 (GRCm39) missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79,600,776 (GRCm39) missense probably benign 0.10
R0413:Col12a1 UTSW 9 79,606,642 (GRCm39) missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79,588,750 (GRCm39) missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79,512,610 (GRCm39) critical splice donor site probably null
R0610:Col12a1 UTSW 9 79,615,130 (GRCm39) missense probably benign
R0631:Col12a1 UTSW 9 79,610,658 (GRCm39) missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79,564,017 (GRCm39) missense probably benign 0.00
R0667:Col12a1 UTSW 9 79,535,744 (GRCm39) missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79,559,317 (GRCm39) missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79,519,701 (GRCm39) missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79,588,656 (GRCm39) splice site probably benign
R0787:Col12a1 UTSW 9 79,545,767 (GRCm39) missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79,607,684 (GRCm39) missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79,591,535 (GRCm39) missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79,607,005 (GRCm39) missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R1321:Col12a1 UTSW 9 79,524,991 (GRCm39) nonsense probably null
R1344:Col12a1 UTSW 9 79,606,837 (GRCm39) nonsense probably null
R1387:Col12a1 UTSW 9 79,588,657 (GRCm39) splice site probably benign
R1511:Col12a1 UTSW 9 79,606,834 (GRCm39) missense probably benign 0.02
R1523:Col12a1 UTSW 9 79,568,278 (GRCm39) missense probably benign 0.01
R1526:Col12a1 UTSW 9 79,564,080 (GRCm39) missense probably benign 0.44
R1564:Col12a1 UTSW 9 79,521,122 (GRCm39) missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79,509,536 (GRCm39) missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79,520,244 (GRCm39) missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79,600,820 (GRCm39) missense probably benign 0.00
R1730:Col12a1 UTSW 9 79,535,660 (GRCm39) missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79,610,733 (GRCm39) missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79,540,750 (GRCm39) missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79,580,279 (GRCm39) missense probably benign 0.01
R1778:Col12a1 UTSW 9 79,511,867 (GRCm39) splice site probably benign
R1845:Col12a1 UTSW 9 79,604,823 (GRCm39) missense probably benign 0.09
R1864:Col12a1 UTSW 9 79,534,385 (GRCm39) splice site probably null
R1876:Col12a1 UTSW 9 79,585,563 (GRCm39) nonsense probably null
R1934:Col12a1 UTSW 9 79,511,804 (GRCm39) nonsense probably null
R1942:Col12a1 UTSW 9 79,542,748 (GRCm39) missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79,553,075 (GRCm39) critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79,524,987 (GRCm39) missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79,569,736 (GRCm39) splice site probably benign
R2070:Col12a1 UTSW 9 79,554,978 (GRCm39) missense probably benign 0.00
R2112:Col12a1 UTSW 9 79,551,181 (GRCm39) missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79,599,634 (GRCm39) missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79,542,709 (GRCm39) missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79,540,939 (GRCm39) missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79,564,095 (GRCm39) missense probably benign 0.03
R2425:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79,509,533 (GRCm39) missense probably benign 0.30
R2437:Col12a1 UTSW 9 79,599,501 (GRCm39) missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79,604,683 (GRCm39) missense probably null 0.99
R2851:Col12a1 UTSW 9 79,585,614 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79,607,547 (GRCm39) missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79,551,229 (GRCm39) missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3430:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3547:Col12a1 UTSW 9 79,540,698 (GRCm39) missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79,547,005 (GRCm39) missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79,609,646 (GRCm39) missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79,607,671 (GRCm39) missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R4392:Col12a1 UTSW 9 79,569,770 (GRCm39) missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79,547,247 (GRCm39) critical splice donor site probably null
R4465:Col12a1 UTSW 9 79,580,192 (GRCm39) missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79,540,639 (GRCm39) missense probably benign 0.00
R4612:Col12a1 UTSW 9 79,523,339 (GRCm39) missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79,554,883 (GRCm39) missense probably benign 0.03
R4649:Col12a1 UTSW 9 79,547,076 (GRCm39) missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79,606,564 (GRCm39) missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79,559,368 (GRCm39) splice site probably null
R4761:Col12a1 UTSW 9 79,564,592 (GRCm39) missense probably benign 0.34
R4784:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79,600,849 (GRCm39) missense probably benign 0.10
R4821:Col12a1 UTSW 9 79,622,622 (GRCm39) intron probably benign
R4925:Col12a1 UTSW 9 79,582,077 (GRCm39) missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79,607,632 (GRCm39) nonsense probably null
R5034:Col12a1 UTSW 9 79,564,649 (GRCm39) missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79,512,456 (GRCm39) missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79,613,582 (GRCm39) missense probably benign 0.00
R5152:Col12a1 UTSW 9 79,564,030 (GRCm39) missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
R5268:Col12a1 UTSW 9 79,585,329 (GRCm39) missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79,527,342 (GRCm39) missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79,521,645 (GRCm39) missense probably benign 0.07
R5496:Col12a1 UTSW 9 79,509,467 (GRCm39) splice site probably benign
R5537:Col12a1 UTSW 9 79,606,872 (GRCm39) missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79,611,041 (GRCm39) missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79,606,603 (GRCm39) missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79,523,347 (GRCm39) nonsense probably null
R5796:Col12a1 UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79,540,955 (GRCm39) missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79,511,760 (GRCm39) missense probably benign 0.00
R5919:Col12a1 UTSW 9 79,509,580 (GRCm39) missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79,589,409 (GRCm39) missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79,585,788 (GRCm39) missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79,537,842 (GRCm39) missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79,563,860 (GRCm39) critical splice donor site probably null
R6090:Col12a1 UTSW 9 79,599,675 (GRCm39) missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79,521,640 (GRCm39) missense probably benign 0.00
R6393:Col12a1 UTSW 9 79,562,767 (GRCm39) missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79,552,973 (GRCm39) missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79,554,887 (GRCm39) missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79,557,231 (GRCm39) missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79,527,331 (GRCm39) missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79,606,887 (GRCm39) missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79,540,706 (GRCm39) missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79,584,516 (GRCm39) missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79,547,091 (GRCm39) missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79,607,782 (GRCm39) missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79,557,314 (GRCm39) missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79,589,348 (GRCm39) missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79,613,642 (GRCm39) missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79,562,689 (GRCm39) missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79,520,192 (GRCm39) splice site probably null
R7584:Col12a1 UTSW 9 79,610,578 (GRCm39) critical splice donor site probably null
R7624:Col12a1 UTSW 9 79,553,076 (GRCm39) splice site probably null
R7670:Col12a1 UTSW 9 79,538,925 (GRCm39) missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79,558,768 (GRCm39) missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79,588,803 (GRCm39) missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79,585,833 (GRCm39) missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79,548,863 (GRCm39) missense probably benign 0.00
R7923:Col12a1 UTSW 9 79,585,775 (GRCm39) missense probably benign 0.00
R7986:Col12a1 UTSW 9 79,511,674 (GRCm39) critical splice donor site probably null
R8004:Col12a1 UTSW 9 79,591,683 (GRCm39) missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79,613,508 (GRCm39) critical splice donor site probably null
R8056:Col12a1 UTSW 9 79,507,220 (GRCm39) missense
R8151:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79,588,831 (GRCm39) missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79,551,224 (GRCm39) missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79,606,594 (GRCm39) missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79,512,465 (GRCm39) missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79,555,979 (GRCm39) missense probably damaging 0.97
R8351:Col12a1 UTSW 9 79,588,694 (GRCm39) missense probably damaging 0.97
R8442:Col12a1 UTSW 9 79,542,781 (GRCm39) missense probably damaging 1.00
R8500:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably damaging 1.00
R8682:Col12a1 UTSW 9 79,568,358 (GRCm39) missense probably benign 0.03
R8700:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R8859:Col12a1 UTSW 9 79,587,681 (GRCm39) nonsense probably null
R8898:Col12a1 UTSW 9 79,599,577 (GRCm39) missense probably benign 0.08
R8930:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8932:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8949:Col12a1 UTSW 9 79,581,970 (GRCm39) missense probably benign 0.17
R8962:Col12a1 UTSW 9 79,538,901 (GRCm39) missense probably damaging 1.00
R9045:Col12a1 UTSW 9 79,582,034 (GRCm39) missense probably benign 0.00
R9080:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably benign 0.06
R9145:Col12a1 UTSW 9 79,527,344 (GRCm39) missense probably benign 0.16
R9163:Col12a1 UTSW 9 79,548,729 (GRCm39) critical splice donor site probably null
R9168:Col12a1 UTSW 9 79,548,783 (GRCm39) nonsense probably null
R9188:Col12a1 UTSW 9 79,509,614 (GRCm39) missense probably benign 0.22
R9258:Col12a1 UTSW 9 79,613,645 (GRCm39) missense probably benign 0.04
R9292:Col12a1 UTSW 9 79,585,805 (GRCm39) missense probably benign 0.33
R9345:Col12a1 UTSW 9 79,541,017 (GRCm39) missense probably benign 0.08
R9382:Col12a1 UTSW 9 79,589,364 (GRCm39) missense probably benign 0.23
R9427:Col12a1 UTSW 9 79,589,445 (GRCm39) missense probably benign 0.15
R9601:Col12a1 UTSW 9 79,525,034 (GRCm39) missense probably damaging 0.98
R9653:Col12a1 UTSW 9 79,584,556 (GRCm39) missense probably benign
R9668:Col12a1 UTSW 9 79,546,960 (GRCm39) nonsense probably null
R9762:Col12a1 UTSW 9 79,527,266 (GRCm39) missense possibly damaging 0.82
X0021:Col12a1 UTSW 9 79,515,767 (GRCm39) missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79,509,506 (GRCm39) missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79,519,674 (GRCm39) splice site probably null
Z1177:Col12a1 UTSW 9 79,507,268 (GRCm39) missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79,546,978 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGTGATGGTGTATGGAGTATCT -3'
(R):5'- TGTACCACAGAAGTGCAAATCTTTTGCT -3'

Sequencing Primer
(F):5'- ggagtaagctcaagggcaag -3'
(R):5'- GCTATGTTCTAGGTGGCTTGAAGA -3'
Posted On 2013-07-11