Mutagenetix > Incidental Mutation

Incidental Mutation 'R0240:Col12a1'

59323

Institutional Source

Beutler Lab

Gene Symbol

Col12a1

Ensembl Gene

ENSMUSG00000032332

Gene Name

collagen, type XII, alpha 1

Synonyms

MMRRC Submission

038478-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.698) question?

Stock #

R0240 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

79598991-79718831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79652033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1858 (S1858T)

Ref Sequence

ENSEMBL: ENSMUSP00000071662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000071750
AA Change: S1858T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: S1858T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	1.7e-8	PFAM
Pfam:Collagen	2802	2855	6.5e-9	PFAM
Pfam:Collagen	2844	2904	1.1e-9	PFAM
Pfam:Collagen	2939	2994	4.6e-8	PFAM
low complexity region	3011	3044	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121227
AA Change: S1858T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: S1858T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	4.7e-9	PFAM
Pfam:Collagen	2802	2861	2.9e-9	PFAM
Pfam:Collagen	2838	2900	7.1e-8	PFAM
Pfam:Collagen	2935	2990	1.3e-8	PFAM
low complexity region	3007	3040	N/A	INTRINSIC

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (112/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,768,402		probably benign	Het
Acsf3	T	C	8: 122,780,181	L71P	probably damaging	Het
Adamts2	A	T	11: 50,775,374	D399V	probably damaging	Het
Adck2	T	A	6: 39,583,818	V380E	probably benign	Het
Alg11	T	A	8: 22,065,452	V243D	possibly damaging	Het
Ankrd27	T	A	7: 35,619,439	L585Q	probably damaging	Het
Atp7a	T	A	X: 106,109,841	N1117K	probably damaging	Het
Cacna1b	G	A	2: 24,638,657		probably benign	Het
Cacna1d	T	A	14: 30,096,969	M1210L	probably benign	Het
Cacna1s	T	C	1: 136,073,496		probably benign	Het
Ccdc155	C	T	7: 45,200,251	A83T	probably benign	Het
Chd7	T	C	4: 8,852,670		probably benign	Het
Cotl1	C	T	8: 119,840,324	W26*	probably null	Het
Csmd3	T	C	15: 47,629,239	T3000A	probably benign	Het
Dcp1a	T	A	14: 30,484,594		probably benign	Het
Ddhd2	A	T	8: 25,739,590		probably null	Het
Dnah8	T	C	17: 30,765,679	I3117T	probably damaging	Het
Dnm3	G	T	1: 162,353,625	Q162K	probably benign	Het
Dpy19l2	G	T	9: 24,658,580	A359D	probably damaging	Het
Ece1	T	A	4: 137,949,435		probably benign	Het
Eif4g3	A	G	4: 138,170,562	K1025R	probably damaging	Het
Eml2	C	A	7: 19,184,872	Y82*	probably null	Het
Eml6	A	G	11: 29,792,367	V1057A	possibly damaging	Het
Eral1	A	G	11: 78,076,058		probably benign	Het
Espl1	T	C	15: 102,312,541	S911P	probably benign	Het
Fbxo8	A	G	8: 56,590,261		probably benign	Het
Flrt1	A	T	19: 7,097,110		probably benign	Het
Fndc7	A	G	3: 108,858,919		probably benign	Het
G3bp1	G	A	11: 55,492,028	G139D	probably damaging	Het
Gabra6	C	T	11: 42,314,947	V351I	probably benign	Het
Galc	A	T	12: 98,252,034	H186Q	probably damaging	Het
Ganab	A	G	19: 8,912,813	D702G	possibly damaging	Het
Gm13762	A	T	2: 88,973,396	L165Q	probably damaging	Het
Hdac10	T	C	15: 89,125,882	E291G	possibly damaging	Het
Hectd3	T	G	4: 117,002,613	V749G	probably damaging	Het
Kcnh1	T	A	1: 192,505,340	I703N	probably benign	Het
Kcnma1	G	A	14: 23,494,579	T505I	probably damaging	Het
Kctd11	A	G	11: 69,879,814	C133R	probably damaging	Het
Lama3	A	T	18: 12,539,823		probably null	Het
Lamb3	T	C	1: 193,335,027	L842P	probably damaging	Het
Ldlr	T	C	9: 21,737,999		probably benign	Het
Lipk	G	A	19: 34,046,810	R336H	probably benign	Het
Lrrc24	T	A	15: 76,723,209	D58V	probably damaging	Het
Lrsam1	A	G	2: 32,955,185	L106P	probably damaging	Het
Milr1	G	A	11: 106,754,896	W88*	probably null	Het
Mmp10	A	G	9: 7,506,543	D340G	probably damaging	Het
Mybpc1	T	A	10: 88,555,738	Y285F	possibly damaging	Het
Ncoa3	A	G	2: 166,054,400	T408A	probably benign	Het
Nefm	T	A	14: 68,121,134	K484*	probably null	Het
Nfasc	A	G	1: 132,601,983	S814P	probably damaging	Het
Nlrp4a	T	C	7: 26,462,516	V863A	probably benign	Het
Nos1	C	T	5: 117,867,883	P223S	probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Olfr1440	A	T	19: 12,394,963	E233D	probably benign	Het
Olfr155	T	A	4: 43,854,512	S68T	probably damaging	Het
Olfr228	A	G	2: 86,483,386	S119P	possibly damaging	Het
Osbpl5	T	C	7: 143,741,669		probably null	Het
Otog	C	A	7: 46,264,032		probably null	Het
Pacs1	A	T	19: 5,156,374	I261N	possibly damaging	Het
Pbx1	G	A	1: 168,203,482	T189I	possibly damaging	Het
Pcnx	T	C	12: 81,947,018	I908T	possibly damaging	Het
Pdxdc1	A	T	16: 13,879,445	W124R	probably damaging	Het
Phex	C	A	X: 157,186,218	D587Y	probably damaging	Het
Plcb3	A	T	19: 6,962,995	D435E	probably benign	Het
Plce1	A	C	19: 38,728,886	K1373T	probably damaging	Het
Prkcd	G	A	14: 30,602,088	A311V	probably damaging	Het
Ptpn3	A	T	4: 57,232,374	S421T	probably benign	Het
Ptprs	T	C	17: 56,436,087		probably null	Het
Qrich1	A	G	9: 108,534,134	D286G	probably damaging	Het
Rcc1	C	A	4: 132,332,915	G393V	probably damaging	Het
Reln	T	C	5: 22,106,045	N290S	probably benign	Het
Rgl1	T	C	1: 152,554,424		probably benign	Het
Rhpn1	C	T	15: 75,714,122	T628I	probably benign	Het
Rilp	A	G	11: 75,510,921	R176G	probably benign	Het
Riok3	C	T	18: 12,155,227	A487V	probably benign	Het
Rnf224	T	C	2: 25,236,207	T45A	probably damaging	Het
Rpa1	A	G	11: 75,328,687	V137A	probably benign	Het
Rps6ka1	C	A	4: 133,848,531	Q693H	probably benign	Het
Scn2a	G	T	2: 65,735,774	V1381F	probably benign	Het
Scp2	T	A	4: 108,098,078	H112L	probably benign	Het
Sdk1	T	C	5: 141,998,747	W696R	probably damaging	Het
Slc26a7	C	A	4: 14,532,651	V408F	probably damaging	Het
Slc28a2	T	A	2: 122,454,527	I332N	probably benign	Het
Slc37a3	A	G	6: 39,337,238	V480A	probably benign	Het
Slc45a4	T	A	15: 73,581,906	E674D	probably benign	Het
Smpd3	T	C	8: 106,265,156	E255G	probably damaging	Het
Snx29	C	T	16: 11,660,553	R658W	probably damaging	Het
Sppl2a	A	T	2: 126,920,336	M275K	probably benign	Het
Stac	T	C	9: 111,635,021	N59S	probably damaging	Het
Stk25	A	T	1: 93,627,060	L131Q	probably damaging	Het
Tep1	C	T	14: 50,863,029		probably benign	Het
Thbs1	C	A	2: 118,114,393	N229K	probably damaging	Het
Tmx2	A	T	2: 84,675,842	H89Q	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tradd	T	C	8: 105,259,292	N209S	possibly damaging	Het
Trappc3l	A	T	10: 34,098,932	R119*	probably null	Het
Trmt1l	G	A	1: 151,457,454		probably benign	Het
Ublcp1	G	T	11: 44,458,277	Y243*	probably null	Het
Uhrf1bp1	T	A	17: 27,895,870		probably benign	Het
Usp24	C	A	4: 106,414,404	C2158*	probably null	Het
Usp34	A	T	11: 23,433,206	K2088N	probably damaging	Het
Vmn1r53	G	C	6: 90,223,943	S133C	probably damaging	Het
Vmn2r52	A	G	7: 10,159,400	V604A	probably damaging	Het
Vmn2r93	A	G	17: 18,304,799	K240E	probably benign	Het
Wdr13	T	G	X: 8,128,045	D242A	probably damaging	Het
Wwp1	C	T	4: 19,641,734		probably null	Het
Zan	G	A	5: 137,398,362	H4311Y	unknown	Het
Zc3h12c	C	A	9: 52,144,083	R123L	possibly damaging	Het
Zfp125	A	T	12: 20,900,561		noncoding transcript	Het
Zfp318	C	T	17: 46,396,813	P266S	probably benign	Het

Other mutations in Col12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col12a1	APN	9	79681537	missense	possibly damaging	0.55
IGL00434:Col12a1	APN	9	79653332	missense	probably benign	0.27
IGL00465:Col12a1	APN	9	79697581	missense	probably damaging	1.00
IGL00568:Col12a1	APN	9	79651477	missense	probably damaging	1.00
IGL00576:Col12a1	APN	9	79647652	missense	probably damaging	1.00
IGL00580:Col12a1	APN	9	79692226	missense	probably benign	0.05
IGL01015:Col12a1	APN	9	79633741	missense	probably damaging	1.00
IGL01124:Col12a1	APN	9	79703847	missense	probably damaging	1.00
IGL01138:Col12a1	APN	9	79678053	missense	probably damaging	1.00
IGL01295:Col12a1	APN	9	79643926	missense	probably damaging	1.00
IGL01630:Col12a1	APN	9	79657366	missense	probably damaging	1.00
IGL01648:Col12a1	APN	9	79601169	makesense	probably null
IGL01878:Col12a1	APN	9	79649975	missense	possibly damaging	0.72
IGL01921:Col12a1	APN	9	79650017	missense	possibly damaging	0.50
IGL02064:Col12a1	APN	9	79692372	missense	probably benign	0.06
IGL02123:Col12a1	APN	9	79662458	critical splice donor site	probably null
IGL02312:Col12a1	APN	9	79681515	missense	probably damaging	1.00
IGL02320:Col12a1	APN	9	79616021	critical splice donor site	probably null
IGL02328:Col12a1	APN	9	79682066	missense	probably damaging	1.00
IGL02342:Col12a1	APN	9	79649896	splice site	probably null
IGL02355:Col12a1	APN	9	79630711	splice site	probably benign
IGL02362:Col12a1	APN	9	79630711	splice site	probably benign
IGL02396:Col12a1	APN	9	79662583	missense	probably benign
IGL02449:Col12a1	APN	9	79641469	missense	probably damaging	1.00
IGL02682:Col12a1	APN	9	79699341	missense	probably damaging	1.00
IGL02751:Col12a1	APN	9	79613859	unclassified	probably benign
IGL02801:Col12a1	APN	9	79608414	splice site	probably null
IGL03001:Col12a1	APN	9	79633673	missense	probably damaging	1.00
IGL03027:Col12a1	APN	9	79641551	missense	probably benign	0.40
IGL03090:Col12a1	APN	9	79678370	missense	probably damaging	1.00
IGL03115:Col12a1	APN	9	79681437	missense	probably damaging	1.00
IGL03220:Col12a1	APN	9	79699483	missense	probably damaging	1.00
IGL03240:Col12a1	APN	9	79678383	splice site	probably null
IGL03348:Col12a1	APN	9	79693430	missense	possibly damaging	0.88
airship	UTSW	9	79706337	missense	possibly damaging	0.65
dirigible	UTSW	9	79703829	missense	possibly damaging	0.73
Feast	UTSW	9	79700262	missense	probably benign	0.00
hardly	UTSW	9	79700350	nonsense	probably null
hearty	UTSW	9	79643966	missense	probably damaging	1.00
Hefty	UTSW	9	79662454	splice site	probably benign
P0045:Col12a1	UTSW	9	79647611	missense	probably damaging	0.99
PIT4260001:Col12a1	UTSW	9	79651380	critical splice donor site	probably null
PIT4280001:Col12a1	UTSW	9	79678105	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0276:Col12a1	UTSW	9	79630741	nonsense	probably null
R0309:Col12a1	UTSW	9	79600011	splice site	probably null
R0336:Col12a1	UTSW	9	79702345	missense	probably damaging	0.98
R0376:Col12a1	UTSW	9	79693494	missense	probably benign	0.10
R0413:Col12a1	UTSW	9	79699360	missense	probably damaging	0.99
R0504:Col12a1	UTSW	9	79681468	missense	possibly damaging	0.90
R0542:Col12a1	UTSW	9	79605328	critical splice donor site	probably null
R0610:Col12a1	UTSW	9	79707848	missense	probably benign
R0631:Col12a1	UTSW	9	79703376	missense	probably damaging	1.00
R0637:Col12a1	UTSW	9	79656735	missense	probably benign	0.00
R0667:Col12a1	UTSW	9	79628462	missense	probably damaging	1.00
R0711:Col12a1	UTSW	9	79652035	missense	probably damaging	1.00
R0717:Col12a1	UTSW	9	79612419	missense	probably damaging	1.00
R0762:Col12a1	UTSW	9	79681374	splice site	probably benign
R0787:Col12a1	UTSW	9	79638485	missense	probably damaging	0.99
R0890:Col12a1	UTSW	9	79700402	missense	probably damaging	0.97
R0900:Col12a1	UTSW	9	79684253	missense	possibly damaging	0.91
R1109:Col12a1	UTSW	9	79699723	missense	probably damaging	1.00
R1264:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R1321:Col12a1	UTSW	9	79617709	nonsense	probably null
R1344:Col12a1	UTSW	9	79699555	nonsense	probably null
R1387:Col12a1	UTSW	9	79681375	splice site	probably benign
R1511:Col12a1	UTSW	9	79699552	missense	probably benign	0.02
R1523:Col12a1	UTSW	9	79660996	missense	probably benign	0.01
R1526:Col12a1	UTSW	9	79656798	missense	probably benign	0.44
R1564:Col12a1	UTSW	9	79613840	missense	probably damaging	1.00
R1595:Col12a1	UTSW	9	79602254	missense	probably damaging	1.00
R1603:Col12a1	UTSW	9	79612962	missense	probably damaging	1.00
R1673:Col12a1	UTSW	9	79693538	missense	probably benign	0.00
R1730:Col12a1	UTSW	9	79628378	missense	possibly damaging	0.93
R1737:Col12a1	UTSW	9	79703451	missense	probably damaging	1.00
R1739:Col12a1	UTSW	9	79633468	missense	probably damaging	0.98
R1748:Col12a1	UTSW	9	79672997	missense	probably benign	0.01
R1778:Col12a1	UTSW	9	79604585	splice site	probably benign
R1845:Col12a1	UTSW	9	79697541	missense	probably benign	0.09
R1864:Col12a1	UTSW	9	79627103	splice site	probably null
R1876:Col12a1	UTSW	9	79678281	nonsense	probably null
R1934:Col12a1	UTSW	9	79604522	nonsense	probably null
R1942:Col12a1	UTSW	9	79635466	missense	probably damaging	1.00
R1950:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R2027:Col12a1	UTSW	9	79645793	critical splice acceptor site	probably null
R2061:Col12a1	UTSW	9	79617705	missense	possibly damaging	0.88
R2064:Col12a1	UTSW	9	79662454	splice site	probably benign
R2070:Col12a1	UTSW	9	79647696	missense	probably benign	0.00
R2112:Col12a1	UTSW	9	79643899	missense	possibly damaging	0.93
R2209:Col12a1	UTSW	9	79692352	missense	possibly damaging	0.83
R2275:Col12a1	UTSW	9	79635427	missense	probably damaging	0.99
R2330:Col12a1	UTSW	9	79633657	missense	probably damaging	0.99
R2373:Col12a1	UTSW	9	79656813	missense	probably benign	0.03
R2425:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R2428:Col12a1	UTSW	9	79602251	missense	probably benign	0.30
R2437:Col12a1	UTSW	9	79692219	missense	probably damaging	0.97
R2831:Col12a1	UTSW	9	79697401	missense	probably null	0.99
R2851:Col12a1	UTSW	9	79678332	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2874:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2904:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2905:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2991:Col12a1	UTSW	9	79700265	missense	probably damaging	1.00
R3402:Col12a1	UTSW	9	79643947	missense	probably damaging	1.00
R3429:Col12a1	UTSW	9	79680311	missense	probably benign
R3430:Col12a1	UTSW	9	79680311	missense	probably benign
R3547:Col12a1	UTSW	9	79633416	missense	probably damaging	1.00
R3789:Col12a1	UTSW	9	79639723	missense	possibly damaging	0.96
R4091:Col12a1	UTSW	9	79702364	missense	probably damaging	0.99
R4328:Col12a1	UTSW	9	79700389	missense	possibly damaging	0.91
R4382:Col12a1	UTSW	9	79630741	nonsense	probably null
R4392:Col12a1	UTSW	9	79662488	missense	probably damaging	1.00
R4405:Col12a1	UTSW	9	79639965	critical splice donor site	probably null
R4465:Col12a1	UTSW	9	79672910	missense	possibly damaging	0.62
R4521:Col12a1	UTSW	9	79633357	missense	probably benign	0.00
R4612:Col12a1	UTSW	9	79616057	missense	probably damaging	0.99
R4613:Col12a1	UTSW	9	79647601	missense	probably benign	0.03
R4649:Col12a1	UTSW	9	79639794	missense	probably damaging	1.00
R4651:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4652:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4738:Col12a1	UTSW	9	79699282	missense	probably damaging	1.00
R4745:Col12a1	UTSW	9	79652086	splice site	probably null
R4761:Col12a1	UTSW	9	79657310	missense	probably benign	0.34
R4784:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4785:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4809:Col12a1	UTSW	9	79693567	missense	probably benign	0.10
R4821:Col12a1	UTSW	9	79715340	intron	probably benign
R4925:Col12a1	UTSW	9	79674795	missense	probably damaging	1.00
R4938:Col12a1	UTSW	9	79700350	nonsense	probably null
R5034:Col12a1	UTSW	9	79657367	missense	probably damaging	1.00
R5133:Col12a1	UTSW	9	79605174	missense	probably damaging	0.99
R5138:Col12a1	UTSW	9	79643966	missense	probably damaging	1.00
R5145:Col12a1	UTSW	9	79706300	missense	probably benign	0.00
R5152:Col12a1	UTSW	9	79656748	missense	probably damaging	1.00
R5237:Col12a1	UTSW	9	79700262	missense	probably benign	0.00
R5268:Col12a1	UTSW	9	79678047	missense	probably damaging	0.99
R5328:Col12a1	UTSW	9	79620060	missense	probably damaging	0.96
R5372:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R5440:Col12a1	UTSW	9	79614363	missense	probably benign	0.07
R5496:Col12a1	UTSW	9	79602185	splice site	probably benign
R5537:Col12a1	UTSW	9	79699590	missense	probably damaging	1.00
R5596:Col12a1	UTSW	9	79703759	missense	probably damaging	1.00
R5677:Col12a1	UTSW	9	79699321	missense	probably damaging	1.00
R5715:Col12a1	UTSW	9	79616065	nonsense	probably null
R5796:Col12a1	UTSW	9	79703829	missense	possibly damaging	0.73
R5829:Col12a1	UTSW	9	79633673	missense	probably damaging	1.00
R5865:Col12a1	UTSW	9	79604478	missense	probably benign	0.00
R5919:Col12a1	UTSW	9	79602298	missense	probably damaging	0.99
R5974:Col12a1	UTSW	9	79682127	missense	probably damaging	0.99
R5981:Col12a1	UTSW	9	79678506	missense	probably damaging	0.99
R5982:Col12a1	UTSW	9	79630560	missense	probably damaging	1.00
R6027:Col12a1	UTSW	9	79656578	critical splice donor site	probably null
R6090:Col12a1	UTSW	9	79692393	missense	probably damaging	1.00
R6293:Col12a1	UTSW	9	79614358	missense	probably benign	0.00
R6393:Col12a1	UTSW	9	79655485	missense	probably damaging	0.99
R6457:Col12a1	UTSW	9	79645691	missense	probably damaging	1.00
R6505:Col12a1	UTSW	9	79647605	missense	probably damaging	0.98
R6508:Col12a1	UTSW	9	79649949	missense	probably damaging	1.00
R6620:Col12a1	UTSW	9	79620049	missense	probably damaging	0.98
R6718:Col12a1	UTSW	9	79699605	missense	probably damaging	1.00
R6752:Col12a1	UTSW	9	79633424	missense	possibly damaging	0.72
R6774:Col12a1	UTSW	9	79706337	missense	possibly damaging	0.65
R6872:Col12a1	UTSW	9	79677234	missense	probably damaging	1.00
R6884:Col12a1	UTSW	9	79639809	missense	possibly damaging	0.92
R6935:Col12a1	UTSW	9	79700500	missense	possibly damaging	0.76
R7198:Col12a1	UTSW	9	79650032	missense	possibly damaging	0.56
R7296:Col12a1	UTSW	9	79682066	missense	probably damaging	1.00
R7365:Col12a1	UTSW	9	79706360	missense	probably damaging	0.99
R7466:Col12a1	UTSW	9	79655407	missense	possibly damaging	0.95
R7516:Col12a1	UTSW	9	79612910	splice site	probably null
R7584:Col12a1	UTSW	9	79703296	critical splice donor site	probably null
R7624:Col12a1	UTSW	9	79645794	splice site	probably null
R7670:Col12a1	UTSW	9	79631643	missense	probably damaging	1.00
R7678:Col12a1	UTSW	9	79651486	missense	probably damaging	0.99
R7702:Col12a1	UTSW	9	79681521	missense	probably damaging	1.00
R7796:Col12a1	UTSW	9	79678551	missense	possibly damaging	0.88
R7902:Col12a1	UTSW	9	79641581	missense	probably benign	0.00
R7923:Col12a1	UTSW	9	79678493	missense	probably benign	0.00
R7986:Col12a1	UTSW	9	79604392	critical splice donor site	probably null
R8004:Col12a1	UTSW	9	79684401	missense	probably damaging	1.00
R8046:Col12a1	UTSW	9	79706226	critical splice donor site	probably null
R8056:Col12a1	UTSW	9	79599938	missense
R8151:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R8203:Col12a1	UTSW	9	79681549	missense	possibly damaging	0.94
R8221:Col12a1	UTSW	9	79643942	missense	probably damaging	1.00
R8294:Col12a1	UTSW	9	79699312	missense	possibly damaging	0.91
R8309:Col12a1	UTSW	9	79605183	missense	possibly damaging	0.68
R8319:Col12a1	UTSW	9	79648697	missense	probably damaging	0.97
R8351:Col12a1	UTSW	9	79681412	missense	probably damaging	0.97
R8442:Col12a1	UTSW	9	79635499	missense	probably damaging	1.00
R8500:Col12a1	UTSW	9	79609851	missense	probably damaging	1.00
R8682:Col12a1	UTSW	9	79661076	missense	probably benign	0.03
R8700:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R8859:Col12a1	UTSW	9	79680399	nonsense	probably null
R8898:Col12a1	UTSW	9	79692295	missense	probably benign	0.08
R8930:Col12a1	UTSW	9	79673383	missense	probably benign
R8932:Col12a1	UTSW	9	79673383	missense	probably benign
R8949:Col12a1	UTSW	9	79674688	missense	probably benign	0.17
R8962:Col12a1	UTSW	9	79631619	missense	probably damaging	1.00
R9045:Col12a1	UTSW	9	79674752	missense	probably benign	0.00
R9080:Col12a1	UTSW	9	79609851	missense	probably benign	0.06
R9145:Col12a1	UTSW	9	79620062	missense	probably benign	0.16
R9163:Col12a1	UTSW	9	79641447	critical splice donor site	probably null
R9168:Col12a1	UTSW	9	79641501	nonsense	probably null
R9188:Col12a1	UTSW	9	79602332	missense	probably benign	0.22
R9258:Col12a1	UTSW	9	79706363	missense	probably benign	0.04
R9292:Col12a1	UTSW	9	79678523	missense	probably benign	0.33
R9345:Col12a1	UTSW	9	79633735	missense	probably benign	0.08
R9382:Col12a1	UTSW	9	79682082	missense	probably benign	0.23
R9427:Col12a1	UTSW	9	79682163	missense	probably benign	0.15
R9601:Col12a1	UTSW	9	79617752	missense	probably damaging	0.98
R9653:Col12a1	UTSW	9	79677274	missense	probably benign
R9668:Col12a1	UTSW	9	79639678	nonsense	probably null
R9762:Col12a1	UTSW	9	79619984	missense	possibly damaging	0.82
X0021:Col12a1	UTSW	9	79608485	missense	probably damaging	1.00
X0058:Col12a1	UTSW	9	79602224	missense	possibly damaging	0.66
X0061:Col12a1	UTSW	9	79612392	splice site	probably null
Z1177:Col12a1	UTSW	9	79599986	missense	possibly damaging	0.80
Z1177:Col12a1	UTSW	9	79639696	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACCACTGTGATGGTGTATGGAGTATCT -3'
(R):5'- TGTACCACAGAAGTGCAAATCTTTTGCT -3'

Sequencing Primer
(F):5'- ggagtaagctcaagggcaag -3'
(R):5'- GCTATGTTCTAGGTGGCTTGAAGA -3'

Posted On

2013-07-11