Incidental Mutation 'R7689:Nos1'
ID 593260
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Name nitric oxide synthase 1, neuronal
Synonyms bNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7689 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 117781032-117958840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117897727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 431 (D431G)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
AlphaFold Q9Z0J4
Predicted Effect probably damaging
Transcript: ENSMUST00000086451
AA Change: D431G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: D431G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102557
AA Change: D431G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: D431G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142742
AA Change: D431G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: D431G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171055
AA Change: D431G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: D431G

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,944,983 F470Y probably damaging Het
4921530L21Rik T C 14: 95,881,816 V3A probably benign Het
Adra1a T C 14: 66,637,801 L75P probably damaging Het
Agap1 T C 1: 89,834,466 S560P probably damaging Het
Arrdc4 T A 7: 68,741,875 I215L probably damaging Het
Atad3a C T 4: 155,756,153 A97T probably damaging Het
BC067074 A G 13: 113,379,414 T121A Het
Bcas3 A T 11: 85,495,887 T383S probably benign Het
C2cd5 G A 6: 143,050,225 R379* probably null Het
C77080 T C 4: 129,223,773 N411S probably benign Het
Cacna1e G T 1: 154,398,803 H2138N probably benign Het
Card14 A T 11: 119,325,502 D303V possibly damaging Het
Cfhr1 T C 1: 139,547,740 Y331C unknown Het
Chp1 G A 2: 119,584,665 D183N probably benign Het
Cntn2 T C 1: 132,516,144 T966A probably benign Het
Cpne9 T G 6: 113,290,004 C133G probably damaging Het
Cul7 C T 17: 46,652,821 Q275* probably null Het
Cyp11b1 T C 15: 74,839,048 D221G probably benign Het
Dmxl1 T A 18: 49,846,618 F107I probably benign Het
Dnhd1 A G 7: 105,713,963 I3911V probably benign Het
Dpcr1 C A 17: 35,638,077 S210I possibly damaging Het
Eloa T C 4: 136,009,284 H551R probably benign Het
Fam171b T A 2: 83,879,388 V468D probably benign Het
Fat2 A G 11: 55,309,840 W803R probably damaging Het
Fbxo43 T C 15: 36,163,055 D2G probably benign Het
Fbxo8 A G 8: 56,588,085 T179A probably benign Het
Gdap1 A G 1: 17,161,399 T323A probably damaging Het
Gm136 T C 4: 34,743,875 N323S probably null Het
Gm4737 T C 16: 46,154,607 T136A probably benign Het
Gm6803 A G 12: 88,018,489 Y95H probably damaging Het
Gm6899 A T 11: 26,593,819 T129S unknown Het
Gnb3 A T 6: 124,837,220 C166S possibly damaging Het
Gpr61 A G 3: 108,150,650 F232L probably damaging Het
Gpx8 T C 13: 113,043,177 M197V probably benign Het
Gse1 G T 8: 120,568,478 R446L unknown Het
Itch A G 2: 155,210,002 K614E probably damaging Het
Itch A T 2: 155,213,067 T764S probably benign Het
Itpkb T G 1: 180,413,979 M738R probably damaging Het
Jph1 T A 1: 17,003,968 K609* probably null Het
Kcns1 G A 2: 164,168,321 R173C probably damaging Het
Larp4b C T 13: 9,136,798 S54L probably damaging Het
Lonrf1 G T 8: 36,248,764 S239* probably null Het
Lyst T G 13: 13,683,223 probably null Het
Mccc1 T A 3: 35,960,983 R663* probably null Het
Mcm3 A G 1: 20,806,773 V646A probably benign Het
Mdn1 T C 4: 32,739,912 L3722P probably damaging Het
Mmp27 T G 9: 7,579,001 D392E probably damaging Het
Ms4a14 A G 19: 11,302,542 I884T probably benign Het
Muc4 C T 16: 32,753,011 T963I probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ndrg2 C T 14: 51,910,355 A102T possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Otog T C 7: 46,252,056 L393P probably damaging Het
Plcl1 A G 1: 55,697,468 N656S probably damaging Het
Pole3 C A 4: 62,524,823 V27F probably damaging Het
Prrt4 T A 6: 29,177,141 I210F probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rbpms A T 8: 33,864,359 S53T possibly damaging Het
Rgs7 C A 1: 175,121,730 V203L probably benign Het
Riok1 A T 13: 38,045,287 D150V probably damaging Het
Rrp1b T C 17: 32,055,926 L335P probably benign Het
Rsph6a T G 7: 19,068,037 I592S possibly damaging Het
Skor1 C T 9: 63,145,379 G436D probably damaging Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Slc22a8 T C 19: 8,607,884 S266P probably damaging Het
Socs2 A G 10: 95,414,983 probably benign Het
Tas2r106 A G 6: 131,678,705 I61T possibly damaging Het
Tfap2a T C 13: 40,728,575 N77D probably damaging Het
Tmem236 T A 2: 14,192,265 L88Q probably damaging Het
Ttc41 A G 10: 86,759,224 E954G probably damaging Het
Vmn1r34 G T 6: 66,637,010 S248* probably null Het
Wipf1 T C 2: 73,432,445 R483G probably damaging Het
Zfhx4 A G 3: 5,411,886 N3187S probably benign Het
Zfp202 C A 9: 40,210,533 P309T probably benign Het
Zfp39 T C 11: 58,890,643 H431R probably damaging Het
Zfp658 T A 7: 43,574,678 H792Q probably benign Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
Crumple UTSW 5 117895860 missense possibly damaging 0.95
penurious UTSW 5 117895902 missense probably damaging 0.97
spendthrift UTSW 5 117953783 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7964:Nos1 UTSW 5 117900542 missense probably damaging 1.00
R8962:Nos1 UTSW 5 117879340 missense probably benign 0.05
R9147:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9148:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9149:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9246:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9248:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9249:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9254:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9255:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9256:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9283:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9320:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9321:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9326:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9327:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9331:Nos1 UTSW 5 117900524 missense possibly damaging 0.59
R9379:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9432:Nos1 UTSW 5 117896806 missense probably damaging 1.00
R9470:Nos1 UTSW 5 117926495 missense probably damaging 1.00
R9581:Nos1 UTSW 5 117905394 missense probably damaging 1.00
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Z1177:Nos1 UTSW 5 117923278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACCAGTCTGGCTCACTCC -3'
(R):5'- AGAAGGGGACAGCCTTTTCC -3'

Sequencing Primer
(F):5'- ACACGTATCCATCATGACCATTTC -3'
(R):5'- TTTTCCCCTGGCAGCTGAGG -3'
Posted On 2019-11-12