Incidental Mutation 'R7689:Gnb3'
ID593264
Institutional Source Beutler Lab
Gene Symbol Gnb3
Ensembl Gene ENSMUSG00000023439
Gene Nameguanine nucleotide binding protein (G protein), beta 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7689 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124834240-124840275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124837220 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 166 (C166S)
Ref Sequence ENSEMBL: ENSMUSP00000024206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000131847] [ENSMUST00000135127] [ENSMUST00000150120] [ENSMUST00000151674]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000024206
AA Change: C166S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439
AA Change: C166S

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
Predicted Effect probably benign
Transcript: ENSMUST00000131847
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150120
Predicted Effect probably benign
Transcript: ENSMUST00000151674
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal light ON response and synaptic maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,944,983 F470Y probably damaging Het
4921530L21Rik T C 14: 95,881,816 V3A probably benign Het
Adra1a T C 14: 66,637,801 L75P probably damaging Het
Agap1 T C 1: 89,834,466 S560P probably damaging Het
Arrdc4 T A 7: 68,741,875 I215L probably damaging Het
Atad3a C T 4: 155,756,153 A97T probably damaging Het
BC067074 A G 13: 113,379,414 T121A Het
Bcas3 A T 11: 85,495,887 T383S probably benign Het
C2cd5 G A 6: 143,050,225 R379* probably null Het
C77080 T C 4: 129,223,773 N411S probably benign Het
Cacna1e G T 1: 154,398,803 H2138N probably benign Het
Card14 A T 11: 119,325,502 D303V possibly damaging Het
Cfhr1 T C 1: 139,547,740 Y331C unknown Het
Chp1 G A 2: 119,584,665 D183N probably benign Het
Cntn2 T C 1: 132,516,144 T966A probably benign Het
Cpne9 T G 6: 113,290,004 C133G probably damaging Het
Cul7 C T 17: 46,652,821 Q275* probably null Het
Cyp11b1 T C 15: 74,839,048 D221G probably benign Het
Dmxl1 T A 18: 49,846,618 F107I probably benign Het
Dnhd1 A G 7: 105,713,963 I3911V probably benign Het
Dpcr1 C A 17: 35,638,077 S210I possibly damaging Het
Eloa T C 4: 136,009,284 H551R probably benign Het
Fam171b T A 2: 83,879,388 V468D probably benign Het
Fat2 A G 11: 55,309,840 W803R probably damaging Het
Fbxo43 T C 15: 36,163,055 D2G probably benign Het
Fbxo8 A G 8: 56,588,085 T179A probably benign Het
Gdap1 A G 1: 17,161,399 T323A probably damaging Het
Gm136 T C 4: 34,743,875 N323S probably null Het
Gm4737 T C 16: 46,154,607 T136A probably benign Het
Gm6803 A G 12: 88,018,489 Y95H probably damaging Het
Gm6899 A T 11: 26,593,819 T129S unknown Het
Gpr61 A G 3: 108,150,650 F232L probably damaging Het
Gpx8 T C 13: 113,043,177 M197V probably benign Het
Gse1 G T 8: 120,568,478 R446L unknown Het
Itch A G 2: 155,210,002 K614E probably damaging Het
Itch A T 2: 155,213,067 T764S probably benign Het
Itpkb T G 1: 180,413,979 M738R probably damaging Het
Jph1 T A 1: 17,003,968 K609* probably null Het
Kcns1 G A 2: 164,168,321 R173C probably damaging Het
Larp4b C T 13: 9,136,798 S54L probably damaging Het
Lonrf1 G T 8: 36,248,764 S239* probably null Het
Lyst T G 13: 13,683,223 probably null Het
Mccc1 T A 3: 35,960,983 R663* probably null Het
Mcm3 A G 1: 20,806,773 V646A probably benign Het
Mdn1 T C 4: 32,739,912 L3722P probably damaging Het
Mmp27 T G 9: 7,579,001 D392E probably damaging Het
Ms4a14 A G 19: 11,302,542 I884T probably benign Het
Muc4 C T 16: 32,753,011 T963I probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ndrg2 C T 14: 51,910,355 A102T possibly damaging Het
Nos1 A G 5: 117,897,727 D431G probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Otog T C 7: 46,252,056 L393P probably damaging Het
Plcl1 A G 1: 55,697,468 N656S probably damaging Het
Pole3 C A 4: 62,524,823 V27F probably damaging Het
Prrt4 T A 6: 29,177,141 I210F probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rbpms A T 8: 33,864,359 S53T possibly damaging Het
Rgs7 C A 1: 175,121,730 V203L probably benign Het
Riok1 A T 13: 38,045,287 D150V probably damaging Het
Rrp1b T C 17: 32,055,926 L335P probably benign Het
Rsph6a T G 7: 19,068,037 I592S possibly damaging Het
Skor1 C T 9: 63,145,379 G436D probably damaging Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Slc22a8 T C 19: 8,607,884 S266P probably damaging Het
Socs2 A G 10: 95,414,983 probably benign Het
Tas2r106 A G 6: 131,678,705 I61T possibly damaging Het
Tfap2a T C 13: 40,728,575 N77D probably damaging Het
Tmem236 T A 2: 14,192,265 L88Q probably damaging Het
Ttc41 A G 10: 86,759,224 E954G probably damaging Het
Vmn1r34 G T 6: 66,637,010 S248* probably null Het
Wipf1 T C 2: 73,432,445 R483G probably damaging Het
Zfhx4 A G 3: 5,411,886 N3187S probably benign Het
Zfp202 C A 9: 40,210,533 P309T probably benign Het
Zfp39 T C 11: 58,890,643 H431R probably damaging Het
Zfp658 T A 7: 43,574,678 H792Q probably benign Het
Other mutations in Gnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gnb3 APN 6 124837255 missense probably damaging 0.98
IGL01707:Gnb3 APN 6 124839689 missense possibly damaging 0.56
IGL02412:Gnb3 APN 6 124837462 missense probably benign 0.23
IGL02606:Gnb3 APN 6 124837415 missense probably benign 0.01
IGL02627:Gnb3 APN 6 124834715 missense probably damaging 0.98
IGL02669:Gnb3 APN 6 124837725 missense probably benign 0.17
R0006:Gnb3 UTSW 6 124835804 unclassified probably benign
R0026:Gnb3 UTSW 6 124837417 missense probably benign 0.00
R0445:Gnb3 UTSW 6 124837255 missense possibly damaging 0.92
R0538:Gnb3 UTSW 6 124835696 nonsense probably null
R1801:Gnb3 UTSW 6 124835636 missense probably benign 0.13
R4074:Gnb3 UTSW 6 124836979 missense probably benign
R6715:Gnb3 UTSW 6 124837728 missense possibly damaging 0.94
R7146:Gnb3 UTSW 6 124836924 critical splice donor site probably null
R7884:Gnb3 UTSW 6 124837092 missense probably benign 0.00
R8198:Gnb3 UTSW 6 124837037 missense probably benign 0.10
X0017:Gnb3 UTSW 6 124837068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTTGTAGTCTGGGGACAC -3'
(R):5'- AGGGCAATGTCAAGGTCAGC -3'

Sequencing Primer
(F):5'- TAGTCTGGGGACACAGCCAG -3'
(R):5'- GCTCTCTGCTCACACAGGTG -3'
Posted On2019-11-12