Incidental Mutation 'R7689:Gpx8'
ID 593293
Institutional Source Beutler Lab
Gene Symbol Gpx8
Ensembl Gene ENSMUSG00000021760
Gene Name glutathione peroxidase 8 (putative)
Synonyms 2310016C16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock # R7689 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 113042753-113046410 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113043177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 197 (M197V)
Ref Sequence ENSEMBL: ENSMUSP00000022282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022282] [ENSMUST00000109244] [ENSMUST00000180543] [ENSMUST00000181117] [ENSMUST00000181568] [ENSMUST00000231962]
AlphaFold Q9D7B7
Predicted Effect probably benign
Transcript: ENSMUST00000022282
AA Change: M197V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022282
Gene: ENSMUSG00000021760
AA Change: M197V

DomainStartEndE-ValueType
Pfam:AhpC-TSA 44 143 1.3e-8 PFAM
Pfam:GSHPx 47 155 5.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109244
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180543
Predicted Effect probably benign
Transcript: ENSMUST00000181117
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181568
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181741
Predicted Effect probably benign
Transcript: ENSMUST00000231962
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice exhibit chronic active dermatitis, with epodermal hyperplasia and hyperkeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,944,983 F470Y probably damaging Het
4921530L21Rik T C 14: 95,881,816 V3A probably benign Het
Adra1a T C 14: 66,637,801 L75P probably damaging Het
Agap1 T C 1: 89,834,466 S560P probably damaging Het
Arrdc4 T A 7: 68,741,875 I215L probably damaging Het
Atad3a C T 4: 155,756,153 A97T probably damaging Het
BC067074 A G 13: 113,379,414 T121A Het
Bcas3 A T 11: 85,495,887 T383S probably benign Het
C2cd5 G A 6: 143,050,225 R379* probably null Het
C77080 T C 4: 129,223,773 N411S probably benign Het
Cacna1e G T 1: 154,398,803 H2138N probably benign Het
Card14 A T 11: 119,325,502 D303V possibly damaging Het
Cfhr1 T C 1: 139,547,740 Y331C unknown Het
Chp1 G A 2: 119,584,665 D183N probably benign Het
Cntn2 T C 1: 132,516,144 T966A probably benign Het
Cpne9 T G 6: 113,290,004 C133G probably damaging Het
Cul7 C T 17: 46,652,821 Q275* probably null Het
Cyp11b1 T C 15: 74,839,048 D221G probably benign Het
Dmxl1 T A 18: 49,846,618 F107I probably benign Het
Dnhd1 A G 7: 105,713,963 I3911V probably benign Het
Dpcr1 C A 17: 35,638,077 S210I possibly damaging Het
Eloa T C 4: 136,009,284 H551R probably benign Het
Fam171b T A 2: 83,879,388 V468D probably benign Het
Fat2 A G 11: 55,309,840 W803R probably damaging Het
Fbxo43 T C 15: 36,163,055 D2G probably benign Het
Fbxo8 A G 8: 56,588,085 T179A probably benign Het
Gdap1 A G 1: 17,161,399 T323A probably damaging Het
Gm136 T C 4: 34,743,875 N323S probably null Het
Gm4737 T C 16: 46,154,607 T136A probably benign Het
Gm6803 A G 12: 88,018,489 Y95H probably damaging Het
Gm6899 A T 11: 26,593,819 T129S unknown Het
Gnb3 A T 6: 124,837,220 C166S possibly damaging Het
Gpr61 A G 3: 108,150,650 F232L probably damaging Het
Gse1 G T 8: 120,568,478 R446L unknown Het
Itch A G 2: 155,210,002 K614E probably damaging Het
Itch A T 2: 155,213,067 T764S probably benign Het
Itpkb T G 1: 180,413,979 M738R probably damaging Het
Jph1 T A 1: 17,003,968 K609* probably null Het
Kcns1 G A 2: 164,168,321 R173C probably damaging Het
Larp4b C T 13: 9,136,798 S54L probably damaging Het
Lonrf1 G T 8: 36,248,764 S239* probably null Het
Lyst T G 13: 13,683,223 probably null Het
Mccc1 T A 3: 35,960,983 R663* probably null Het
Mcm3 A G 1: 20,806,773 V646A probably benign Het
Mdn1 T C 4: 32,739,912 L3722P probably damaging Het
Mmp27 T G 9: 7,579,001 D392E probably damaging Het
Ms4a14 A G 19: 11,302,542 I884T probably benign Het
Muc4 C T 16: 32,753,011 T963I probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ndrg2 C T 14: 51,910,355 A102T possibly damaging Het
Nos1 A G 5: 117,897,727 D431G probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Otog T C 7: 46,252,056 L393P probably damaging Het
Plcl1 A G 1: 55,697,468 N656S probably damaging Het
Pole3 C A 4: 62,524,823 V27F probably damaging Het
Prrt4 T A 6: 29,177,141 I210F probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rbpms A T 8: 33,864,359 S53T possibly damaging Het
Rgs7 C A 1: 175,121,730 V203L probably benign Het
Riok1 A T 13: 38,045,287 D150V probably damaging Het
Rrp1b T C 17: 32,055,926 L335P probably benign Het
Rsph6a T G 7: 19,068,037 I592S possibly damaging Het
Skor1 C T 9: 63,145,379 G436D probably damaging Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Slc22a8 T C 19: 8,607,884 S266P probably damaging Het
Socs2 A G 10: 95,414,983 probably benign Het
Tas2r106 A G 6: 131,678,705 I61T possibly damaging Het
Tfap2a T C 13: 40,728,575 N77D probably damaging Het
Tmem236 T A 2: 14,192,265 L88Q probably damaging Het
Ttc41 A G 10: 86,759,224 E954G probably damaging Het
Vmn1r34 G T 6: 66,637,010 S248* probably null Het
Wipf1 T C 2: 73,432,445 R483G probably damaging Het
Zfhx4 A G 3: 5,411,886 N3187S probably benign Het
Zfp202 C A 9: 40,210,533 P309T probably benign Het
Zfp39 T C 11: 58,890,643 H431R probably damaging Het
Zfp658 T A 7: 43,574,678 H792Q probably benign Het
Other mutations in Gpx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Gpx8 APN 13 113045513 missense possibly damaging 0.61
IGL01110:Gpx8 APN 13 113045684 missense probably benign 0.06
IGL02190:Gpx8 APN 13 113043309 splice site probably benign
IGL03085:Gpx8 APN 13 113043261 missense probably damaging 1.00
IGL03369:Gpx8 APN 13 113043162 missense probably damaging 0.97
R0597:Gpx8 UTSW 13 113045501 missense possibly damaging 0.72
R1494:Gpx8 UTSW 13 113045615 missense possibly damaging 0.95
R1906:Gpx8 UTSW 13 113045576 missense probably damaging 1.00
R1941:Gpx8 UTSW 13 113046275 missense probably damaging 1.00
R2174:Gpx8 UTSW 13 113045606 missense probably benign 0.08
R4414:Gpx8 UTSW 13 113043148 missense possibly damaging 0.69
R4860:Gpx8 UTSW 13 113045508 nonsense probably null
R4860:Gpx8 UTSW 13 113045508 nonsense probably null
R6920:Gpx8 UTSW 13 113043236 missense probably damaging 1.00
R7904:Gpx8 UTSW 13 113045501 missense probably benign 0.14
R8849:Gpx8 UTSW 13 113043170 missense probably benign 0.28
X0062:Gpx8 UTSW 13 113043175 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACATTTCTATCTTGGGGACAGC -3'
(R):5'- ATTAAAGCTCTGACCTCTGCTC -3'

Sequencing Primer
(F):5'- TTGGGGACAGCCATTACATC -3'
(R):5'- GACCTCTGCTCTCTGTGGTG -3'
Posted On 2019-11-12