Incidental Mutation 'R7689:Ms4a14'
ID593307
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7689 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11302542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 884 (I884T)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect probably benign
Transcript: ENSMUST00000187467
AA Change: I884T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: I884T

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 147,944,983 F470Y probably damaging Het
4921530L21Rik T C 14: 95,881,816 V3A probably benign Het
Adra1a T C 14: 66,637,801 L75P probably damaging Het
Agap1 T C 1: 89,834,466 S560P probably damaging Het
Arrdc4 T A 7: 68,741,875 I215L probably damaging Het
Atad3a C T 4: 155,756,153 A97T probably damaging Het
BC067074 A G 13: 113,379,414 T121A Het
Bcas3 A T 11: 85,495,887 T383S probably benign Het
C2cd5 G A 6: 143,050,225 R379* probably null Het
C77080 T C 4: 129,223,773 N411S probably benign Het
Cacna1e G T 1: 154,398,803 H2138N probably benign Het
Card14 A T 11: 119,325,502 D303V possibly damaging Het
Cfhr1 T C 1: 139,547,740 Y331C unknown Het
Chp1 G A 2: 119,584,665 D183N probably benign Het
Cntn2 T C 1: 132,516,144 T966A probably benign Het
Cpne9 T G 6: 113,290,004 C133G probably damaging Het
Cul7 C T 17: 46,652,821 Q275* probably null Het
Cyp11b1 T C 15: 74,839,048 D221G probably benign Het
Dmxl1 T A 18: 49,846,618 F107I probably benign Het
Dnhd1 A G 7: 105,713,963 I3911V probably benign Het
Dpcr1 C A 17: 35,638,077 S210I possibly damaging Het
Eloa T C 4: 136,009,284 H551R probably benign Het
Fam171b T A 2: 83,879,388 V468D probably benign Het
Fat2 A G 11: 55,309,840 W803R probably damaging Het
Fbxo43 T C 15: 36,163,055 D2G probably benign Het
Fbxo8 A G 8: 56,588,085 T179A probably benign Het
Gdap1 A G 1: 17,161,399 T323A probably damaging Het
Gm136 T C 4: 34,743,875 N323S probably null Het
Gm4737 T C 16: 46,154,607 T136A probably benign Het
Gm6803 A G 12: 88,018,489 Y95H probably damaging Het
Gm6899 A T 11: 26,593,819 T129S unknown Het
Gnb3 A T 6: 124,837,220 C166S possibly damaging Het
Gpr61 A G 3: 108,150,650 F232L probably damaging Het
Gpx8 T C 13: 113,043,177 M197V probably benign Het
Gse1 G T 8: 120,568,478 R446L unknown Het
Itch A G 2: 155,210,002 K614E probably damaging Het
Itch A T 2: 155,213,067 T764S probably benign Het
Itpkb T G 1: 180,413,979 M738R probably damaging Het
Jph1 T A 1: 17,003,968 K609* probably null Het
Kcns1 G A 2: 164,168,321 R173C probably damaging Het
Larp4b C T 13: 9,136,798 S54L probably damaging Het
Lonrf1 G T 8: 36,248,764 S239* probably null Het
Lyst T G 13: 13,683,223 probably null Het
Mccc1 T A 3: 35,960,983 R663* probably null Het
Mcm3 A G 1: 20,806,773 V646A probably benign Het
Mdn1 T C 4: 32,739,912 L3722P probably damaging Het
Mmp27 T G 9: 7,579,001 D392E probably damaging Het
Muc4 C T 16: 32,753,011 T963I probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ndrg2 C T 14: 51,910,355 A102T possibly damaging Het
Nos1 A G 5: 117,897,727 D431G probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Otog T C 7: 46,252,056 L393P probably damaging Het
Plcl1 A G 1: 55,697,468 N656S probably damaging Het
Pole3 C A 4: 62,524,823 V27F probably damaging Het
Prrt4 T A 6: 29,177,141 I210F probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rbpms A T 8: 33,864,359 S53T possibly damaging Het
Rgs7 C A 1: 175,121,730 V203L probably benign Het
Riok1 A T 13: 38,045,287 D150V probably damaging Het
Rrp1b T C 17: 32,055,926 L335P probably benign Het
Rsph6a T G 7: 19,068,037 I592S possibly damaging Het
Skor1 C T 9: 63,145,379 G436D probably damaging Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Slc22a8 T C 19: 8,607,884 S266P probably damaging Het
Socs2 A G 10: 95,414,983 probably benign Het
Tas2r106 A G 6: 131,678,705 I61T possibly damaging Het
Tfap2a T C 13: 40,728,575 N77D probably damaging Het
Tmem236 T A 2: 14,192,265 L88Q probably damaging Het
Ttc41 A G 10: 86,759,224 E954G probably damaging Het
Vmn1r34 G T 6: 66,637,010 S248* probably null Het
Wipf1 T C 2: 73,432,445 R483G probably damaging Het
Zfhx4 A G 3: 5,411,886 N3187S probably benign Het
Zfp202 C A 9: 40,210,533 P309T probably benign Het
Zfp39 T C 11: 58,890,643 H431R probably damaging Het
Zfp658 T A 7: 43,574,678 H792Q probably benign Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7445:Ms4a14 UTSW 19 11302972 missense probably benign 0.00
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7532:Ms4a14 UTSW 19 11303959 missense possibly damaging 0.86
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGATTGTTGTACTGGGACCTCC -3'
(R):5'- TTATAGGGACATTCGAACAGAAGTC -3'

Sequencing Primer
(F):5'- GTACTGGGACCTCCTCTTTGG -3'
(R):5'- TCGAACAGAAGTCATGGAGCTAACTC -3'
Posted On2019-11-12