Incidental Mutation 'R7690:Nlrp9b'
ID593334
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene NameNLR family, pyrin domain containing 9B
SynonymsNalp-delta, Nalp9b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7690 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19991465-20073306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20024370 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 511 (P511T)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909] [ENSMUST00000137183]
Predicted Effect probably benign
Transcript: ENSMUST00000073151
AA Change: P511T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: P511T

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137183
SMART Domains Protein: ENSMUSP00000115158
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 240 1.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,314,154 T710S probably benign Het
Adgrl2 A G 3: 148,817,298 L430P Het
Agap1 T C 1: 89,843,071 S648P probably benign Het
Alox5 T C 6: 116,415,456 H368R probably damaging Het
Ano2 T C 6: 126,013,198 F761L probably damaging Het
Aox4 T C 1: 58,263,917 V1169A probably damaging Het
Apbb1ip T A 2: 22,816,984 M11K unknown Het
Arl5a G T 2: 52,412,065 H112Q possibly damaging Het
Ccdc18 C T 5: 108,228,662 T1323I probably benign Het
Cmtm5 G A 14: 54,936,481 probably benign Het
Cul2 T C 18: 3,419,420 Y194H probably benign Het
Daglb T C 5: 143,494,183 I415T possibly damaging Het
Ddx28 A G 8: 106,010,331 V365A probably damaging Het
Eppk1 T A 15: 76,111,746 T312S probably benign Het
Erich4 C A 7: 25,615,285 V68L possibly damaging Het
Fam171a2 G A 11: 102,437,834 P700S probably benign Het
Fat3 T C 9: 15,998,181 N2175S probably damaging Het
Fcrl6 T G 1: 172,598,656 R191S probably damaging Het
Fpgt A G 3: 155,087,830 S187P probably damaging Het
Gapvd1 T G 2: 34,729,122 T80P possibly damaging Het
Gclm A G 3: 122,246,056 N24S probably damaging Het
Gdf15 A G 8: 70,631,347 I89T possibly damaging Het
Gpn2 A G 4: 133,591,382 E306G probably damaging Het
Iars2 A T 1: 185,320,997 L359Q probably damaging Het
Kbtbd4 T G 2: 90,905,896 C84G possibly damaging Het
Manea A G 4: 26,327,910 V377A probably benign Het
Map4 C T 9: 109,999,793 T82I probably damaging Het
Mocos C T 18: 24,664,025 H81Y probably damaging Het
Mtx1 T A 3: 89,212,781 T87S Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myom2 A T 8: 15,111,717 probably null Het
Mzt1 C T 14: 99,040,588 C48Y probably damaging Het
Noc2l A G 4: 156,237,631 E135G probably benign Het
Nova1 G A 12: 46,720,766 P124L unknown Het
Pax8 T A 2: 24,441,670 T134S probably benign Het
Pde4a T A 9: 21,166,004 L26Q probably damaging Het
Pde6b G A 5: 108,419,518 E254K probably damaging Het
Pdlim7 A G 13: 55,508,931 I70T probably damaging Het
Pomt2 C A 12: 87,130,367 R352L probably damaging Het
Rapgef5 G A 12: 117,721,370 V519I possibly damaging Het
Rnps1 A G 17: 24,418,194 E16G unknown Het
Slc4a5 T C 6: 83,285,872 F782S probably damaging Het
Snap91 A G 9: 86,824,978 V253A possibly damaging Het
Syce3 T C 15: 89,397,341 M32V possibly damaging Het
Tcaf3 C A 6: 42,597,135 V48L probably damaging Het
Tenm4 T C 7: 96,863,533 V1366A probably benign Het
Tnxb G A 17: 34,689,520 M1382I probably benign Het
Tnxb G A 17: 34,689,527 G1385R probably damaging Het
Top3a G T 11: 60,756,380 L238I probably damaging Het
Trim9 A T 12: 70,248,343 N742K probably benign Het
Trp63 T A 16: 25,876,733 Y482N unknown Het
Ttc23 T G 7: 67,670,170 F192V possibly damaging Het
Uck1 A G 2: 32,258,172 V180A probably benign Het
Vwa5b1 G A 4: 138,590,933 T541I probably damaging Het
Zfp456 G T 13: 67,366,794 H264Q probably damaging Het
Zfpm2 T G 15: 40,954,766 V165G possibly damaging Het
Zufsp C T 10: 33,930,155 probably null Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6265:Nlrp9b UTSW 7 20062683 missense probably benign
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 20049508 missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 20045766 missense probably benign 0.04
R7573:Nlrp9b UTSW 7 20019200 missense probably damaging 1.00
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCATGTTCTATTTCCTCAAACAAG -3'
(R):5'- AGGATTTCTGCAGAGCATATGC -3'

Sequencing Primer
(F):5'- GTTCTATTTCCTCAAACAAGACAAAG -3'
(R):5'- GCAGAGCATATGCAGTCACTG -3'
Posted On2019-11-12