Incidental Mutation 'R7690:Map4'
ID593345
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7690 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109999793 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 82 (T82I)
Ref Sequence ENSEMBL: ENSMUSP00000035055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876] [ENSMUST00000169851]
Predicted Effect probably damaging
Transcript: ENSMUST00000035055
AA Change: T82I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: T82I

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165876
AA Change: T82I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: T82I

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169851
AA Change: T82I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,314,154 T710S probably benign Het
Adgrl2 A G 3: 148,817,298 L430P Het
Agap1 T C 1: 89,843,071 S648P probably benign Het
Alox5 T C 6: 116,415,456 H368R probably damaging Het
Ano2 T C 6: 126,013,198 F761L probably damaging Het
Aox4 T C 1: 58,263,917 V1169A probably damaging Het
Apbb1ip T A 2: 22,816,984 M11K unknown Het
Arl5a G T 2: 52,412,065 H112Q possibly damaging Het
Ccdc18 C T 5: 108,228,662 T1323I probably benign Het
Cmtm5 G A 14: 54,936,481 probably benign Het
Cul2 T C 18: 3,419,420 Y194H probably benign Het
Daglb T C 5: 143,494,183 I415T possibly damaging Het
Ddx28 A G 8: 106,010,331 V365A probably damaging Het
Dnah6 T C 6: 73,169,080 probably null Het
Eppk1 T A 15: 76,111,746 T312S probably benign Het
Erich4 C A 7: 25,615,285 V68L possibly damaging Het
Fam171a2 G A 11: 102,437,834 P700S probably benign Het
Fat3 T C 9: 15,998,181 N2175S probably damaging Het
Fcrl6 T G 1: 172,598,656 R191S probably damaging Het
Fpgt A G 3: 155,087,830 S187P probably damaging Het
Gapvd1 T G 2: 34,729,122 T80P possibly damaging Het
Gclm A G 3: 122,246,056 N24S probably damaging Het
Gdf15 A G 8: 70,631,347 I89T possibly damaging Het
Gpn2 A G 4: 133,591,382 E306G probably damaging Het
Iars2 A T 1: 185,320,997 L359Q probably damaging Het
Kbtbd4 T G 2: 90,905,896 C84G possibly damaging Het
Manea A G 4: 26,327,910 V377A probably benign Het
Mocos C T 18: 24,664,025 H81Y probably damaging Het
Mtx1 T A 3: 89,212,781 T87S Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myom2 A T 8: 15,111,717 probably null Het
Mzt1 C T 14: 99,040,588 C48Y probably damaging Het
Nlrp9b C A 7: 20,024,370 P511T probably benign Het
Noc2l A G 4: 156,237,631 E135G probably benign Het
Nova1 G A 12: 46,720,766 P124L unknown Het
Pax8 T A 2: 24,441,670 T134S probably benign Het
Pde4a T A 9: 21,166,004 L26Q probably damaging Het
Pde6b G A 5: 108,419,518 E254K probably damaging Het
Pdlim7 A G 13: 55,508,931 I70T probably damaging Het
Pinx1 T A 14: 63,864,211 probably null Het
Pomt2 C A 12: 87,130,367 R352L probably damaging Het
Rapgef5 G A 12: 117,721,370 V519I possibly damaging Het
Rnps1 A G 17: 24,418,194 E16G unknown Het
Slc4a5 T C 6: 83,285,872 F782S probably damaging Het
Snap91 A G 9: 86,824,978 V253A possibly damaging Het
Syce3 T C 15: 89,397,341 M32V possibly damaging Het
Tcaf3 C A 6: 42,597,135 V48L probably damaging Het
Tenm4 T C 7: 96,863,533 V1366A probably benign Het
Tnxb G A 17: 34,689,520 M1382I probably benign Het
Tnxb G A 17: 34,689,527 G1385R probably damaging Het
Top3a G T 11: 60,756,380 L238I probably damaging Het
Trim9 A T 12: 70,248,343 N742K probably benign Het
Trp63 T A 16: 25,876,733 Y482N unknown Het
Ttc23 T G 7: 67,670,170 F192V possibly damaging Het
Uck1 A G 2: 32,258,172 V180A probably benign Het
Vwa5b1 G A 4: 138,590,933 T541I probably damaging Het
Zfp456 G T 13: 67,366,794 H264Q probably damaging Het
Zfpm2 T G 15: 40,954,766 V165G possibly damaging Het
Zufsp C T 10: 33,930,155 probably null Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7469:Map4 UTSW 9 110027797 splice site probably null
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTGTGGTGATAATACTGAAAGGTG -3'
(R):5'- CCATCCAATACTTGTGTGGTTCAC -3'

Sequencing Primer
(F):5'- TGATAATACTGAAAGGTGTGAGTGG -3'
(R):5'- CTTGTGTGGTTCACTTCCAATAAAC -3'
Posted On2019-11-12