Incidental Mutation 'R0240:Rpa1'
ID 59335
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission 038478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0240 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75328687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect probably benign
Transcript: ENSMUST00000000767
AA Change: V137A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: V137A

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092907
AA Change: V116A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: V116A

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154894
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,768,402 probably benign Het
Acsf3 T C 8: 122,780,181 L71P probably damaging Het
Adamts2 A T 11: 50,775,374 D399V probably damaging Het
Adck2 T A 6: 39,583,818 V380E probably benign Het
Alg11 T A 8: 22,065,452 V243D possibly damaging Het
Ankrd27 T A 7: 35,619,439 L585Q probably damaging Het
Atp7a T A X: 106,109,841 N1117K probably damaging Het
Cacna1b G A 2: 24,638,657 probably benign Het
Cacna1d T A 14: 30,096,969 M1210L probably benign Het
Cacna1s T C 1: 136,073,496 probably benign Het
Ccdc155 C T 7: 45,200,251 A83T probably benign Het
Chd7 T C 4: 8,852,670 probably benign Het
Col12a1 A T 9: 79,652,033 S1858T probably benign Het
Cotl1 C T 8: 119,840,324 W26* probably null Het
Csmd3 T C 15: 47,629,239 T3000A probably benign Het
Dcp1a T A 14: 30,484,594 probably benign Het
Ddhd2 A T 8: 25,739,590 probably null Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Dnm3 G T 1: 162,353,625 Q162K probably benign Het
Dpy19l2 G T 9: 24,658,580 A359D probably damaging Het
Ece1 T A 4: 137,949,435 probably benign Het
Eif4g3 A G 4: 138,170,562 K1025R probably damaging Het
Eml2 C A 7: 19,184,872 Y82* probably null Het
Eml6 A G 11: 29,792,367 V1057A possibly damaging Het
Eral1 A G 11: 78,076,058 probably benign Het
Espl1 T C 15: 102,312,541 S911P probably benign Het
Fbxo8 A G 8: 56,590,261 probably benign Het
Flrt1 A T 19: 7,097,110 probably benign Het
Fndc7 A G 3: 108,858,919 probably benign Het
G3bp1 G A 11: 55,492,028 G139D probably damaging Het
Gabra6 C T 11: 42,314,947 V351I probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Ganab A G 19: 8,912,813 D702G possibly damaging Het
Gm13762 A T 2: 88,973,396 L165Q probably damaging Het
Hdac10 T C 15: 89,125,882 E291G possibly damaging Het
Hectd3 T G 4: 117,002,613 V749G probably damaging Het
Kcnh1 T A 1: 192,505,340 I703N probably benign Het
Kcnma1 G A 14: 23,494,579 T505I probably damaging Het
Kctd11 A G 11: 69,879,814 C133R probably damaging Het
Lama3 A T 18: 12,539,823 probably null Het
Lamb3 T C 1: 193,335,027 L842P probably damaging Het
Ldlr T C 9: 21,737,999 probably benign Het
Lipk G A 19: 34,046,810 R336H probably benign Het
Lrrc24 T A 15: 76,723,209 D58V probably damaging Het
Lrsam1 A G 2: 32,955,185 L106P probably damaging Het
Milr1 G A 11: 106,754,896 W88* probably null Het
Mmp10 A G 9: 7,506,543 D340G probably damaging Het
Mybpc1 T A 10: 88,555,738 Y285F possibly damaging Het
Ncoa3 A G 2: 166,054,400 T408A probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nfasc A G 1: 132,601,983 S814P probably damaging Het
Nlrp4a T C 7: 26,462,516 V863A probably benign Het
Nos1 C T 5: 117,867,883 P223S probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1440 A T 19: 12,394,963 E233D probably benign Het
Olfr155 T A 4: 43,854,512 S68T probably damaging Het
Olfr228 A G 2: 86,483,386 S119P possibly damaging Het
Osbpl5 T C 7: 143,741,669 probably null Het
Otog C A 7: 46,264,032 probably null Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Pbx1 G A 1: 168,203,482 T189I possibly damaging Het
Pcnx T C 12: 81,947,018 I908T possibly damaging Het
Pdxdc1 A T 16: 13,879,445 W124R probably damaging Het
Phex C A X: 157,186,218 D587Y probably damaging Het
Plcb3 A T 19: 6,962,995 D435E probably benign Het
Plce1 A C 19: 38,728,886 K1373T probably damaging Het
Prkcd G A 14: 30,602,088 A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 S421T probably benign Het
Ptprs T C 17: 56,436,087 probably null Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Rcc1 C A 4: 132,332,915 G393V probably damaging Het
Reln T C 5: 22,106,045 N290S probably benign Het
Rgl1 T C 1: 152,554,424 probably benign Het
Rhpn1 C T 15: 75,714,122 T628I probably benign Het
Rilp A G 11: 75,510,921 R176G probably benign Het
Riok3 C T 18: 12,155,227 A487V probably benign Het
Rnf224 T C 2: 25,236,207 T45A probably damaging Het
Rps6ka1 C A 4: 133,848,531 Q693H probably benign Het
Scn2a G T 2: 65,735,774 V1381F probably benign Het
Scp2 T A 4: 108,098,078 H112L probably benign Het
Sdk1 T C 5: 141,998,747 W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 V408F probably damaging Het
Slc28a2 T A 2: 122,454,527 I332N probably benign Het
Slc37a3 A G 6: 39,337,238 V480A probably benign Het
Slc45a4 T A 15: 73,581,906 E674D probably benign Het
Smpd3 T C 8: 106,265,156 E255G probably damaging Het
Snx29 C T 16: 11,660,553 R658W probably damaging Het
Sppl2a A T 2: 126,920,336 M275K probably benign Het
Stac T C 9: 111,635,021 N59S probably damaging Het
Stk25 A T 1: 93,627,060 L131Q probably damaging Het
Tep1 C T 14: 50,863,029 probably benign Het
Thbs1 C A 2: 118,114,393 N229K probably damaging Het
Tmx2 A T 2: 84,675,842 H89Q probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tradd T C 8: 105,259,292 N209S possibly damaging Het
Trappc3l A T 10: 34,098,932 R119* probably null Het
Trmt1l G A 1: 151,457,454 probably benign Het
Ublcp1 G T 11: 44,458,277 Y243* probably null Het
Uhrf1bp1 T A 17: 27,895,870 probably benign Het
Usp24 C A 4: 106,414,404 C2158* probably null Het
Usp34 A T 11: 23,433,206 K2088N probably damaging Het
Vmn1r53 G C 6: 90,223,943 S133C probably damaging Het
Vmn2r52 A G 7: 10,159,400 V604A probably damaging Het
Vmn2r93 A G 17: 18,304,799 K240E probably benign Het
Wdr13 T G X: 8,128,045 D242A probably damaging Het
Wwp1 C T 4: 19,641,734 probably null Het
Zan G A 5: 137,398,362 H4311Y unknown Het
Zc3h12c C A 9: 52,144,083 R123L possibly damaging Het
Zfp125 A T 12: 20,900,561 noncoding transcript Het
Zfp318 C T 17: 46,396,813 P266S probably benign Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R7938:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8837:Rpa1 UTSW 11 75313341 missense possibly damaging 0.70
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTCTCTAGTCCCATGCACACAC -3'
(R):5'- TGCAGCAAGGTCTACTGTTTTAATCAGG -3'

Sequencing Primer
(F):5'- CGCGTGTAAATACGTAGATGTTCAC -3'
(R):5'- GTTGGTAAAGGATACAGTTTTAGCC -3'
Posted On 2013-07-11