Mutagenetix > Incidental Mutation

Incidental Mutation 'R7690:Zfpm2'

593357

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7690 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40954766 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 165 (V165G)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053467
AA Change: V165G

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: V165G

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230319
AA Change: V33G

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0644

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,314,154	T710S	probably benign	Het
Adgrl2	A	G	3: 148,817,298	L430P		Het
Agap1	T	C	1: 89,843,071	S648P	probably benign	Het
Alox5	T	C	6: 116,415,456	H368R	probably damaging	Het
Ano2	T	C	6: 126,013,198	F761L	probably damaging	Het
Aox4	T	C	1: 58,263,917	V1169A	probably damaging	Het
Apbb1ip	T	A	2: 22,816,984	M11K	unknown	Het
Arl5a	G	T	2: 52,412,065	H112Q	possibly damaging	Het
Ccdc18	C	T	5: 108,228,662	T1323I	probably benign	Het
Cmtm5	G	A	14: 54,936,481		probably benign	Het
Cul2	T	C	18: 3,419,420	Y194H	probably benign	Het
Daglb	T	C	5: 143,494,183	I415T	possibly damaging	Het
Ddx28	A	G	8: 106,010,331	V365A	probably damaging	Het
Dnah6	T	C	6: 73,169,080		probably null	Het
Eppk1	T	A	15: 76,111,746	T312S	probably benign	Het
Erich4	C	A	7: 25,615,285	V68L	possibly damaging	Het
Fam171a2	G	A	11: 102,437,834	P700S	probably benign	Het
Fat3	T	C	9: 15,998,181	N2175S	probably damaging	Het
Fcrl6	T	G	1: 172,598,656	R191S	probably damaging	Het
Fpgt	A	G	3: 155,087,830	S187P	probably damaging	Het
Gapvd1	T	G	2: 34,729,122	T80P	possibly damaging	Het
Gclm	A	G	3: 122,246,056	N24S	probably damaging	Het
Gdf15	A	G	8: 70,631,347	I89T	possibly damaging	Het
Gpn2	A	G	4: 133,591,382	E306G	probably damaging	Het
Iars2	A	T	1: 185,320,997	L359Q	probably damaging	Het
Kbtbd4	T	G	2: 90,905,896	C84G	possibly damaging	Het
Manea	A	G	4: 26,327,910	V377A	probably benign	Het
Map4	C	T	9: 109,999,793	T82I	probably damaging	Het
Mocos	C	T	18: 24,664,025	H81Y	probably damaging	Het
Mtx1	T	A	3: 89,212,781	T87S		Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Myom2	A	T	8: 15,111,717		probably null	Het
Mzt1	C	T	14: 99,040,588	C48Y	probably damaging	Het
Nlrp9b	C	A	7: 20,024,370	P511T	probably benign	Het
Noc2l	A	G	4: 156,237,631	E135G	probably benign	Het
Nova1	G	A	12: 46,720,766	P124L	unknown	Het
Pax8	T	A	2: 24,441,670	T134S	probably benign	Het
Pde4a	T	A	9: 21,166,004	L26Q	probably damaging	Het
Pde6b	G	A	5: 108,419,518	E254K	probably damaging	Het
Pdlim7	A	G	13: 55,508,931	I70T	probably damaging	Het
Pinx1	T	A	14: 63,864,211		probably null	Het
Pomt2	C	A	12: 87,130,367	R352L	probably damaging	Het
Rapgef5	G	A	12: 117,721,370	V519I	possibly damaging	Het
Rnps1	A	G	17: 24,418,194	E16G	unknown	Het
Slc4a5	T	C	6: 83,285,872	F782S	probably damaging	Het
Snap91	A	G	9: 86,824,978	V253A	possibly damaging	Het
Syce3	T	C	15: 89,397,341	M32V	possibly damaging	Het
Tcaf3	C	A	6: 42,597,135	V48L	probably damaging	Het
Tenm4	T	C	7: 96,863,533	V1366A	probably benign	Het
Tnxb	G	A	17: 34,689,520	M1382I	probably benign	Het
Tnxb	G	A	17: 34,689,527	G1385R	probably damaging	Het
Top3a	G	T	11: 60,756,380	L238I	probably damaging	Het
Trim9	A	T	12: 70,248,343	N742K	probably benign	Het
Trp63	T	A	16: 25,876,733	Y482N	unknown	Het
Ttc23	T	G	7: 67,670,170	F192V	possibly damaging	Het
Uck1	A	G	2: 32,258,172	V180A	probably benign	Het
Vwa5b1	G	A	4: 138,590,933	T541I	probably damaging	Het
Zfp456	G	T	13: 67,366,794	H264Q	probably damaging	Het
Zufsp	C	T	10: 33,930,155		probably null	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TAAGAGCCTTCCAGCTTCCG -3'
(R):5'- GCACTGAGGCTTTCAAAGGAAG -3'

Sequencing Primer
(F):5'- TTCCGGCCTCTTAAAAATATACCAGG -3'
(R):5'- GAGGGAAGTGAGAGGCTTACGTC -3'

Posted On

2019-11-12