Incidental Mutation 'R7690:Rnps1'
ID593361
Institutional Source Beutler Lab
Gene Symbol Rnps1
Ensembl Gene ENSMUSG00000034681
Gene Nameribonucleic acid binding protein S1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7690 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24414675-24425895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24418194 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 16 (E16G)
Ref Sequence ENSEMBL: ENSMUSP00000085867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088512] [ENSMUST00000115371] [ENSMUST00000163717]
Predicted Effect unknown
Transcript: ENSMUST00000088512
AA Change: E16G
SMART Domains Protein: ENSMUSP00000085867
Gene: ENSMUSG00000034681
AA Change: E16G

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115371
SMART Domains Protein: ENSMUSP00000111028
Gene: ENSMUSG00000034681

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 32 134 N/A INTRINSIC
RRM 139 213 5.12e-21 SMART
low complexity region 220 282 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163717
AA Change: E16G
SMART Domains Protein: ENSMUSP00000126345
Gene: ENSMUSG00000034681
AA Change: E16G

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,314,154 T710S probably benign Het
Adgrl2 A G 3: 148,817,298 L430P Het
Agap1 T C 1: 89,843,071 S648P probably benign Het
Alox5 T C 6: 116,415,456 H368R probably damaging Het
Ano2 T C 6: 126,013,198 F761L probably damaging Het
Aox4 T C 1: 58,263,917 V1169A probably damaging Het
Apbb1ip T A 2: 22,816,984 M11K unknown Het
Arl5a G T 2: 52,412,065 H112Q possibly damaging Het
Ccdc18 C T 5: 108,228,662 T1323I probably benign Het
Cmtm5 G A 14: 54,936,481 probably benign Het
Cul2 T C 18: 3,419,420 Y194H probably benign Het
Daglb T C 5: 143,494,183 I415T possibly damaging Het
Ddx28 A G 8: 106,010,331 V365A probably damaging Het
Dnah6 T C 6: 73,169,080 probably null Het
Eppk1 T A 15: 76,111,746 T312S probably benign Het
Erich4 C A 7: 25,615,285 V68L possibly damaging Het
Fam171a2 G A 11: 102,437,834 P700S probably benign Het
Fat3 T C 9: 15,998,181 N2175S probably damaging Het
Fcrl6 T G 1: 172,598,656 R191S probably damaging Het
Fpgt A G 3: 155,087,830 S187P probably damaging Het
Gapvd1 T G 2: 34,729,122 T80P possibly damaging Het
Gclm A G 3: 122,246,056 N24S probably damaging Het
Gdf15 A G 8: 70,631,347 I89T possibly damaging Het
Gpn2 A G 4: 133,591,382 E306G probably damaging Het
Iars2 A T 1: 185,320,997 L359Q probably damaging Het
Kbtbd4 T G 2: 90,905,896 C84G possibly damaging Het
Manea A G 4: 26,327,910 V377A probably benign Het
Map4 C T 9: 109,999,793 T82I probably damaging Het
Mocos C T 18: 24,664,025 H81Y probably damaging Het
Mtx1 T A 3: 89,212,781 T87S Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myom2 A T 8: 15,111,717 probably null Het
Mzt1 C T 14: 99,040,588 C48Y probably damaging Het
Nlrp9b C A 7: 20,024,370 P511T probably benign Het
Noc2l A G 4: 156,237,631 E135G probably benign Het
Nova1 G A 12: 46,720,766 P124L unknown Het
Pax8 T A 2: 24,441,670 T134S probably benign Het
Pde4a T A 9: 21,166,004 L26Q probably damaging Het
Pde6b G A 5: 108,419,518 E254K probably damaging Het
Pdlim7 A G 13: 55,508,931 I70T probably damaging Het
Pinx1 T A 14: 63,864,211 probably null Het
Pomt2 C A 12: 87,130,367 R352L probably damaging Het
Rapgef5 G A 12: 117,721,370 V519I possibly damaging Het
Slc4a5 T C 6: 83,285,872 F782S probably damaging Het
Snap91 A G 9: 86,824,978 V253A possibly damaging Het
Syce3 T C 15: 89,397,341 M32V possibly damaging Het
Tcaf3 C A 6: 42,597,135 V48L probably damaging Het
Tenm4 T C 7: 96,863,533 V1366A probably benign Het
Tnxb G A 17: 34,689,520 M1382I probably benign Het
Tnxb G A 17: 34,689,527 G1385R probably damaging Het
Top3a G T 11: 60,756,380 L238I probably damaging Het
Trim9 A T 12: 70,248,343 N742K probably benign Het
Trp63 T A 16: 25,876,733 Y482N unknown Het
Ttc23 T G 7: 67,670,170 F192V possibly damaging Het
Uck1 A G 2: 32,258,172 V180A probably benign Het
Vwa5b1 G A 4: 138,590,933 T541I probably damaging Het
Zfp456 G T 13: 67,366,794 H264Q probably damaging Het
Zfpm2 T G 15: 40,954,766 V165G possibly damaging Het
Zufsp C T 10: 33,930,155 probably null Het
Other mutations in Rnps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Rnps1 APN 17 24422299 missense probably damaging 1.00
IGL01433:Rnps1 APN 17 24424545 critical splice donor site probably null
IGL01984:Rnps1 APN 17 24424397 splice site probably benign
IGL03410:Rnps1 APN 17 24421861 splice site probably benign
unbalanced UTSW 17 24422168 missense probably damaging 1.00
R0594:Rnps1 UTSW 17 24424437 missense probably damaging 0.99
R1397:Rnps1 UTSW 17 24412057 unclassified probably benign
R1938:Rnps1 UTSW 17 24420390 missense unknown
R2321:Rnps1 UTSW 17 24422168 missense probably damaging 1.00
R3085:Rnps1 UTSW 17 24412419 unclassified probably benign
R3086:Rnps1 UTSW 17 24412419 unclassified probably benign
R4296:Rnps1 UTSW 17 24425115 unclassified probably benign
R5159:Rnps1 UTSW 17 24418512 missense unknown
R5193:Rnps1 UTSW 17 24418543 missense probably benign 0.23
R5753:Rnps1 UTSW 17 24418164 intron probably benign
R7378:Rnps1 UTSW 17 24418530 missense unknown
R7403:Rnps1 UTSW 17 24425087 missense unknown
R8104:Rnps1 UTSW 17 24424510 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGCTCAACGGTCTTTGATG -3'
(R):5'- ATCCCAGGTGATCACAGAGC -3'

Sequencing Primer
(F):5'- GCTCAACGGTCTTTGATGCAAAATAG -3'
(R):5'- GTGATCACAGAGCAAAATCATCTGTG -3'
Posted On2019-11-12