Mutagenetix > Incidental Mutation

Incidental Mutation 'R7691:Stk39'

593376

Institutional Source

Beutler Lab

Gene Symbol

Stk39

Ensembl Gene

ENSMUSG00000027030

Gene Name

serine/threonine kinase 39

Synonyms

DCHT, Rnl5, RF005, SPAK

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R7691 (G1)

Quality Score

175.009

Status

Not validated

Chromosome

Chromosomal Location

68210445-68472268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68471639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 80 (V80A)

Ref Sequence

ENSEMBL: ENSMUSP00000099776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102715]

AlphaFold

Q9Z1W9

Predicted Effect

probably damaging
Transcript: ENSMUST00000102715
AA Change: V80A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: V80A

Domain	Start	End	E-Value	Type
low complexity region	14	65	N/A	INTRINSIC
S_TKc	75	349	4.44e-80	SMART
Pfam:OSR1_C	463	494	1.3e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	T	6: 92,796,238	C1763S	probably damaging	Het
Adcy3	T	C	12: 4,206,540	V782A	probably benign	Het
Arhgef17	G	A	7: 100,929,642	R700C	probably damaging	Het
Atxn2l	T	C	7: 126,492,610		probably null	Het
Bach2	A	G	4: 32,580,271	E832G	probably damaging	Het
Brpf3	G	C	17: 28,806,831	A293P	probably damaging	Het
Cacfd1	T	C	2: 27,010,094	L36P	probably damaging	Het
Camsap2	T	C	1: 136,293,004	E268G	probably damaging	Het
Ccnjl	A	T	11: 43,583,201	Q201L	probably benign	Het
Cdan1	A	G	2: 120,729,567	V372A	probably damaging	Het
Cenpf	C	A	1: 189,658,207	E1143*	probably null	Het
Colgalt1	A	T	8: 71,620,754	M340L	probably benign	Het
Crybg3	A	G	16: 59,556,134	Y1586H	not run	Het
Csmd3	A	G	15: 47,741,173	I1058T		Het
Dock1	G	A	7: 135,138,157		probably null	Het
Dzank1	G	A	2: 144,506,171	T225I	probably damaging	Het
Eif3c	G	A	7: 126,551,990	R721W	possibly damaging	Het
Fdps	A	G	3: 89,099,367	V72A	probably benign	Het
Filip1l	A	G	16: 57,572,433	N1128S	probably benign	Het
Fmnl2	T	A	2: 53,101,498	Y342N	unknown	Het
Gria1	A	T	11: 57,236,987	I410F	possibly damaging	Het
Gsdmc4	C	A	15: 63,893,791	S303I	probably damaging	Het
Herc2	C	T	7: 56,191,845	P3491S	probably benign	Het
Hspb11	A	G	4: 107,273,689	I59V	probably benign	Het
Lama2	T	C	10: 27,208,393	H927R	possibly damaging	Het
Lrrc8e	T	C	8: 4,234,534	M253T	probably damaging	Het
Ltn1	G	T	16: 87,398,686	H1317Q	probably damaging	Het
Map6	C	T	7: 99,336,292	L671F	possibly damaging	Het
Mki67	C	T	7: 135,701,992	V716I	not run	Het
Mllt10	A	G	2: 18,203,611	S694G	possibly damaging	Het
Mllt10	G	C	2: 18,203,612	S694T	probably null	Het
Mtcl1	A	G	17: 66,380,357	L518S	probably damaging	Het
Olfr1368	G	A	13: 21,142,970	A29V	probably benign	Het
Pcdh10	G	T	3: 45,381,197	D649Y	probably damaging	Het
Pdgfrb	C	T	18: 61,061,268	T39M	probably benign	Het
Pls1	T	C	9: 95,773,673	E342G	probably benign	Het
Pon1	C	T	6: 5,175,819	V235I	probably benign	Het
Rhobtb3	A	T	13: 75,878,937	V439E	probably damaging	Het
Sept8	A	G	11: 53,537,587	T355A	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Ssc5d	C	T	7: 4,944,169	T1174I	probably benign	Het
Sspo	A	T	6: 48,484,229	T3535S	probably benign	Het
Sult2b1	T	C	7: 45,735,284	I123V	probably benign	Het
Sv2a	A	T	3: 96,188,411	I348F	probably benign	Het
Taar8b	T	A	10: 24,091,538	R253*	probably null	Het
Tbc1d4	T	C	14: 101,507,641	K183R	probably damaging	Het
Tet2	T	A	3: 133,486,849	D608V	probably damaging	Het
Tnfsf14	T	A	17: 57,194,024	T16S	possibly damaging	Het
Togaram2	A	G	17: 71,716,410	T774A	probably benign	Het
Tshr	C	A	12: 91,497,741	A87E	probably benign	Het
Tsn	T	C	1: 118,309,775	D53G	probably benign	Het
Usp37	TC	T	1: 74,486,760		probably null	Het
Vav2	T	A	2: 27,297,738		probably null	Het
Vmn2r52	T	A	7: 10,159,182	I677F	probably damaging	Het
Vmn2r65	T	A	7: 84,943,643	Y452F	probably benign	Het
Vmn2r79	A	G	7: 87,037,903	R831G	probably damaging	Het
Zfp821	T	C	8: 109,721,239	S71P	probably damaging	Het
Zwilch	T	A	9: 64,156,091	I286F	probably benign	Het

Other mutations in Stk39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Stk39	APN	2	68314564	missense	possibly damaging	0.81
IGL00966:Stk39	APN	2	68211958	missense	probably benign	0.01
IGL01936:Stk39	APN	2	68314564	missense	probably benign	0.21
IGL02301:Stk39	APN	2	68211962	missense	probably damaging	1.00
IGL02940:Stk39	APN	2	68220899	splice site	probably null
claimjumper	UTSW	2	68314579	missense	probably damaging	0.96
outlaw	UTSW	2	68307039	critical splice donor site	probably null
rustler	UTSW	2	68263303	missense	probably damaging	1.00
R0570:Stk39	UTSW	2	68410048	missense	probably damaging	1.00
R0609:Stk39	UTSW	2	68366167	missense	probably damaging	1.00
R0670:Stk39	UTSW	2	68366182	missense	possibly damaging	0.93
R0980:Stk39	UTSW	2	68392171	missense	probably damaging	1.00
R1024:Stk39	UTSW	2	68410046	missense	probably damaging	1.00
R1573:Stk39	UTSW	2	68390949	missense	probably damaging	1.00
R1713:Stk39	UTSW	2	68307116	splice site	probably benign
R2223:Stk39	UTSW	2	68314579	missense	probably damaging	0.96
R3700:Stk39	UTSW	2	68392118	missense	probably damaging	1.00
R4207:Stk39	UTSW	2	68220920	missense	probably benign	0.42
R4298:Stk39	UTSW	2	68390940	missense	probably damaging	1.00
R4726:Stk39	UTSW	2	68263303	missense	probably damaging	1.00
R4975:Stk39	UTSW	2	68220992	intron	probably benign
R5057:Stk39	UTSW	2	68220948	missense	probably damaging	0.99
R5384:Stk39	UTSW	2	68410039	missense	probably damaging	1.00
R5921:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R6125:Stk39	UTSW	2	68392124	missense	probably damaging	1.00
R6251:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R6332:Stk39	UTSW	2	68410043	missense	possibly damaging	0.93
R6375:Stk39	UTSW	2	68392238	missense	probably benign	0.34
R7057:Stk39	UTSW	2	68410127	missense	possibly damaging	0.88
R7064:Stk39	UTSW	2	68358812	critical splice donor site	probably null
R7921:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R8155:Stk39	UTSW	2	68267066	missense	probably damaging	1.00
R8920:Stk39	UTSW	2	68471847	missense	unknown
R9003:Stk39	UTSW	2	68392118	missense	probably damaging	0.98
R9530:Stk39	UTSW	2	68368411	missense	probably damaging	1.00
R9682:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R9784:Stk39	UTSW	2	68368431	missense	probably damaging	1.00
Z1176:Stk39	UTSW	2	68392198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATAAAAGTTTGCAGCCTGC -3'
(R):5'- GTTTCAAGTGGAAGGTCGTCCG -3'

Sequencing Primer
(F):5'- TCGTCTGCAGTGCGAGTCAC -3'
(R):5'- GCACGTCCAGCTTTCCCAG -3'

Posted On

2019-11-12