Incidental Mutation 'R7691:Fdps'
ID593380
Institutional Source Beutler Lab
Gene Symbol Fdps
Ensembl Gene ENSMUSG00000059743
Gene Namefarnesyl diphosphate synthetase
Synonyms6030492I17Rik, Fdpsl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7691 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89093588-89101959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89099367 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000080531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081848] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably benign
Transcript: ENSMUST00000081848
AA Change: V72A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: V72A

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196709
AA Change: V72A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: V72A

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196921
AA Change: V139A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743
AA Change: V139A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199668
AA Change: V72A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743
AA Change: V72A

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200659
AA Change: V139A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: V139A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,796,238 C1763S probably damaging Het
Adcy3 T C 12: 4,206,540 V782A probably benign Het
Arhgef17 G A 7: 100,929,642 R700C probably damaging Het
Atxn2l T C 7: 126,492,610 probably null Het
Bach2 A G 4: 32,580,271 E832G probably damaging Het
Brpf3 G C 17: 28,806,831 A293P probably damaging Het
Cacfd1 T C 2: 27,010,094 L36P probably damaging Het
Camsap2 T C 1: 136,293,004 E268G probably damaging Het
Ccnjl A T 11: 43,583,201 Q201L probably benign Het
Cdan1 A G 2: 120,729,567 V372A probably damaging Het
Cenpf C A 1: 189,658,207 E1143* probably null Het
Colgalt1 A T 8: 71,620,754 M340L probably benign Het
Crybg3 A G 16: 59,556,134 Y1586H not run Het
Csmd3 A G 15: 47,741,173 I1058T Het
Dock1 G A 7: 135,138,157 probably null Het
Dzank1 G A 2: 144,506,171 T225I probably damaging Het
Eif3c G A 7: 126,551,990 R721W possibly damaging Het
Filip1l A G 16: 57,572,433 N1128S probably benign Het
Fmnl2 T A 2: 53,101,498 Y342N unknown Het
Gria1 A T 11: 57,236,987 I410F possibly damaging Het
Gsdmc4 C A 15: 63,893,791 S303I probably damaging Het
Herc2 C T 7: 56,191,845 P3491S probably benign Het
Hspb11 A G 4: 107,273,689 I59V probably benign Het
Lama2 T C 10: 27,208,393 H927R possibly damaging Het
Lrrc8e T C 8: 4,234,534 M253T probably damaging Het
Ltn1 G T 16: 87,398,686 H1317Q probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mki67 C T 7: 135,701,992 V716I not run Het
Mllt10 A G 2: 18,203,611 S694G possibly damaging Het
Mllt10 G C 2: 18,203,612 S694T probably null Het
Mtcl1 A G 17: 66,380,357 L518S probably damaging Het
Olfr1368 G A 13: 21,142,970 A29V probably benign Het
Pcdh10 G T 3: 45,381,197 D649Y probably damaging Het
Pdgfrb C T 18: 61,061,268 T39M probably benign Het
Pls1 T C 9: 95,773,673 E342G probably benign Het
Pon1 C T 6: 5,175,819 V235I probably benign Het
Rhobtb3 A T 13: 75,878,937 V439E probably damaging Het
Sept8 A G 11: 53,537,587 T355A probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Ssc5d C T 7: 4,944,169 T1174I probably benign Het
Sspo A T 6: 48,484,229 T3535S probably benign Het
Stk39 A G 2: 68,471,639 V80A probably damaging Het
Sult2b1 T C 7: 45,735,284 I123V probably benign Het
Sv2a A T 3: 96,188,411 I348F probably benign Het
Taar8b T A 10: 24,091,538 R253* probably null Het
Tbc1d4 T C 14: 101,507,641 K183R probably damaging Het
Tet2 T A 3: 133,486,849 D608V probably damaging Het
Tnfsf14 T A 17: 57,194,024 T16S possibly damaging Het
Togaram2 A G 17: 71,716,410 T774A probably benign Het
Tshr C A 12: 91,497,741 A87E probably benign Het
Tsn T C 1: 118,309,775 D53G probably benign Het
Usp37 TC T 1: 74,486,760 probably null Het
Vav2 T A 2: 27,297,738 probably null Het
Vmn2r52 T A 7: 10,159,182 I677F probably damaging Het
Vmn2r65 T A 7: 84,943,643 Y452F probably benign Het
Vmn2r79 A G 7: 87,037,903 R831G probably damaging Het
Zfp821 T C 8: 109,721,239 S71P probably damaging Het
Zwilch T A 9: 64,156,091 I286F probably benign Het
Other mutations in Fdps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Fdps APN 3 89094442 splice site probably benign
IGL01364:Fdps APN 3 89094270 nonsense probably null
broadside UTSW 3 89100761 missense probably damaging 1.00
R0245:Fdps UTSW 3 89093771 missense possibly damaging 0.84
R0385:Fdps UTSW 3 89094894 missense probably damaging 1.00
R1674:Fdps UTSW 3 89100730 missense probably benign 0.33
R1820:Fdps UTSW 3 89095043 missense probably benign
R4467:Fdps UTSW 3 89100786 missense possibly damaging 0.71
R5106:Fdps UTSW 3 89099403 missense probably damaging 0.99
R5700:Fdps UTSW 3 89095649 missense probably damaging 1.00
R6128:Fdps UTSW 3 89099433 missense possibly damaging 0.77
R6791:Fdps UTSW 3 89095352 critical splice donor site probably null
R6800:Fdps UTSW 3 89100761 missense probably damaging 1.00
R6812:Fdps UTSW 3 89094476 missense possibly damaging 0.51
R6927:Fdps UTSW 3 89093651 missense probably benign 0.41
R7585:Fdps UTSW 3 89093806 missense probably benign 0.17
R7599:Fdps UTSW 3 89099386 missense probably benign 0.05
R7709:Fdps UTSW 3 89101090 missense probably damaging 0.97
R8035:Fdps UTSW 3 89095476 missense probably benign 0.04
R8132:Fdps UTSW 3 89099386 nonsense probably null
R8297:Fdps UTSW 3 89093741 missense probably damaging 0.99
R8323:Fdps UTSW 3 89095389 missense possibly damaging 0.93
X0060:Fdps UTSW 3 89094314 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGTGACTACAGCACACAAGAG -3'
(R):5'- CAGCCCATAGGATGTTGGAG -3'

Sequencing Primer
(F):5'- TGACTACAGCACACAAGAGACACAG -3'
(R):5'- TGATCCAGGGGCTCTCCAAG -3'
Posted On2019-11-12