Incidental Mutation 'R7691:Adamts9'
ID 593387
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms Mhdaund3, Mhdaund4, 1810011L16Rik, 8430403M15Rik, E030027K14Rik, Gsfund3, UND3, UND4
MMRRC Submission 045755-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7691 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 92749680-92920473 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92773219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1763 (C1763S)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
AlphaFold E9PUN6
Predicted Effect probably damaging
Transcript: ENSMUST00000113438
AA Change: C1763S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: C1763S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167391
AA Change: C1182S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: C1182S

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T C 12: 4,256,540 (GRCm39) V782A probably benign Het
Arhgef17 G A 7: 100,578,849 (GRCm39) R700C probably damaging Het
Atxn2l T C 7: 126,091,782 (GRCm39) probably null Het
Bach2 A G 4: 32,580,271 (GRCm39) E832G probably damaging Het
Brpf3 G C 17: 29,025,805 (GRCm39) A293P probably damaging Het
Cacfd1 T C 2: 26,900,106 (GRCm39) L36P probably damaging Het
Camsap2 T C 1: 136,220,742 (GRCm39) E268G probably damaging Het
Ccnjl A T 11: 43,474,028 (GRCm39) Q201L probably benign Het
Cdan1 A G 2: 120,560,048 (GRCm39) V372A probably damaging Het
Cenpf C A 1: 189,390,404 (GRCm39) E1143* probably null Het
Colgalt1 A T 8: 72,073,398 (GRCm39) M340L probably benign Het
Crybg3 A G 16: 59,376,497 (GRCm39) Y1586H not run Het
Csmd3 A G 15: 47,604,569 (GRCm39) I1058T Het
Dock1 G A 7: 134,739,886 (GRCm39) probably null Het
Dzank1 G A 2: 144,348,091 (GRCm39) T225I probably damaging Het
Eif3c G A 7: 126,151,162 (GRCm39) R721W possibly damaging Het
Fdps A G 3: 89,006,674 (GRCm39) V72A probably benign Het
Filip1l A G 16: 57,392,796 (GRCm39) N1128S probably benign Het
Fmnl2 T A 2: 52,991,510 (GRCm39) Y342N unknown Het
Gria1 A T 11: 57,127,813 (GRCm39) I410F possibly damaging Het
Gsdmc4 C A 15: 63,765,640 (GRCm39) S303I probably damaging Het
Herc2 C T 7: 55,841,593 (GRCm39) P3491S probably benign Het
Ift25 A G 4: 107,130,886 (GRCm39) I59V probably benign Het
Lama2 T C 10: 27,084,389 (GRCm39) H927R possibly damaging Het
Lrrc8e T C 8: 4,284,534 (GRCm39) M253T probably damaging Het
Ltn1 G T 16: 87,195,574 (GRCm39) H1317Q probably damaging Het
Map6 C T 7: 98,985,499 (GRCm39) L671F possibly damaging Het
Mki67 C T 7: 135,303,721 (GRCm39) V716I not run Het
Mllt10 A G 2: 18,208,422 (GRCm39) S694G possibly damaging Het
Mllt10 G C 2: 18,208,423 (GRCm39) S694T probably null Het
Mtcl1 A G 17: 66,687,352 (GRCm39) L518S probably damaging Het
Or2ad1 G A 13: 21,327,140 (GRCm39) A29V probably benign Het
Pcdh10 G T 3: 45,335,632 (GRCm39) D649Y probably damaging Het
Pdgfrb C T 18: 61,194,340 (GRCm39) T39M probably benign Het
Pls1 T C 9: 95,655,726 (GRCm39) E342G probably benign Het
Pon1 C T 6: 5,175,819 (GRCm39) V235I probably benign Het
Rhobtb3 A T 13: 76,027,056 (GRCm39) V439E probably damaging Het
Septin8 A G 11: 53,428,414 (GRCm39) T355A probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Ssc5d C T 7: 4,947,168 (GRCm39) T1174I probably benign Het
Sspo A T 6: 48,461,163 (GRCm39) T3535S probably benign Het
Stk39 A G 2: 68,301,983 (GRCm39) V80A probably damaging Het
Sult2b1 T C 7: 45,384,708 (GRCm39) I123V probably benign Het
Sv2a A T 3: 96,095,727 (GRCm39) I348F probably benign Het
Taar8b T A 10: 23,967,436 (GRCm39) R253* probably null Het
Tbc1d4 T C 14: 101,745,077 (GRCm39) K183R probably damaging Het
Tet2 T A 3: 133,192,610 (GRCm39) D608V probably damaging Het
Tnfsf14 T A 17: 57,501,024 (GRCm39) T16S possibly damaging Het
Togaram2 A G 17: 72,023,405 (GRCm39) T774A probably benign Het
Tshr C A 12: 91,464,515 (GRCm39) A87E probably benign Het
Tsn T C 1: 118,237,505 (GRCm39) D53G probably benign Het
Usp37 TC T 1: 74,525,919 (GRCm39) probably null Het
Vav2 T A 2: 27,187,750 (GRCm39) probably null Het
Vmn2r52 T A 7: 9,893,109 (GRCm39) I677F probably damaging Het
Vmn2r65 T A 7: 84,592,851 (GRCm39) Y452F probably benign Het
Vmn2r79 A G 7: 86,687,111 (GRCm39) R831G probably damaging Het
Zfp821 T C 8: 110,447,871 (GRCm39) S71P probably damaging Het
Zwilch T A 9: 64,063,373 (GRCm39) I286F probably benign Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92,836,883 (GRCm39) missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92,837,155 (GRCm39) missense probably benign 0.00
IGL01462:Adamts9 APN 6 92,871,247 (GRCm39) missense probably benign 0.04
IGL01551:Adamts9 APN 6 92,784,001 (GRCm39) missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92,835,128 (GRCm39) splice site probably benign
IGL01638:Adamts9 APN 6 92,849,409 (GRCm39) missense probably benign 0.19
IGL01757:Adamts9 APN 6 92,773,140 (GRCm39) missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92,754,420 (GRCm39) missense probably benign 0.00
IGL02379:Adamts9 APN 6 92,774,014 (GRCm39) missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92,773,978 (GRCm39) missense probably benign 0.04
IGL02554:Adamts9 APN 6 92,857,828 (GRCm39) missense probably benign 0.01
IGL02832:Adamts9 APN 6 92,784,156 (GRCm39) missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92,866,918 (GRCm39) missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92,864,413 (GRCm39) nonsense probably null
IGL03401:Adamts9 APN 6 92,763,849 (GRCm39) missense probably damaging 0.97
basilisk UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
bluebeard UTSW 6 92,856,940 (GRCm39) nonsense probably null
Serpent UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
PIT4402001:Adamts9 UTSW 6 92,849,328 (GRCm39) missense probably benign
PIT4458001:Adamts9 UTSW 6 92,866,886 (GRCm39) missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0067:Adamts9 UTSW 6 92,867,148 (GRCm39) missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92,920,066 (GRCm39) missense probably benign
R0326:Adamts9 UTSW 6 92,835,038 (GRCm39) nonsense probably null
R0396:Adamts9 UTSW 6 92,774,986 (GRCm39) missense probably benign 0.00
R0490:Adamts9 UTSW 6 92,849,847 (GRCm39) missense probably benign
R0504:Adamts9 UTSW 6 92,889,626 (GRCm39) missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92,835,094 (GRCm39) missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92,857,938 (GRCm39) missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92,880,783 (GRCm39) missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92,773,414 (GRCm39) missense probably benign
R1433:Adamts9 UTSW 6 92,826,271 (GRCm39) critical splice donor site probably null
R1558:Adamts9 UTSW 6 92,885,692 (GRCm39) missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92,857,604 (GRCm39) missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92,840,357 (GRCm39) missense probably benign 0.27
R1855:Adamts9 UTSW 6 92,878,350 (GRCm39) splice site probably benign
R1887:Adamts9 UTSW 6 92,849,769 (GRCm39) critical splice donor site probably null
R1934:Adamts9 UTSW 6 92,920,102 (GRCm39) missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92,836,830 (GRCm39) missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92,773,375 (GRCm39) missense probably benign
R2370:Adamts9 UTSW 6 92,837,184 (GRCm39) missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92,889,812 (GRCm39) missense probably benign
R2432:Adamts9 UTSW 6 92,834,881 (GRCm39) missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92,772,891 (GRCm39) splice site probably benign
R3015:Adamts9 UTSW 6 92,849,913 (GRCm39) missense probably benign 0.05
R3611:Adamts9 UTSW 6 92,846,965 (GRCm39) missense probably benign 0.05
R4024:Adamts9 UTSW 6 92,849,765 (GRCm39) splice site probably benign
R4292:Adamts9 UTSW 6 92,772,977 (GRCm39) missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92,836,845 (GRCm39) missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92,856,940 (GRCm39) nonsense probably null
R4677:Adamts9 UTSW 6 92,793,587 (GRCm39) start codon destroyed probably null
R5114:Adamts9 UTSW 6 92,867,254 (GRCm39) missense probably benign 0.03
R5260:Adamts9 UTSW 6 92,784,118 (GRCm39) missense probably benign 0.00
R5384:Adamts9 UTSW 6 92,774,999 (GRCm39) missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92,857,678 (GRCm39) missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92,831,346 (GRCm39) missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92,775,114 (GRCm39) missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92,880,767 (GRCm39) missense probably benign 0.02
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92,867,099 (GRCm39) missense probably damaging 1.00
R6051:Adamts9 UTSW 6 92,836,907 (GRCm39) missense possibly damaging 0.83
R6082:Adamts9 UTSW 6 92,866,930 (GRCm39) missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92,774,002 (GRCm39) missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92,867,101 (GRCm39) missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92,849,316 (GRCm39) missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92,882,172 (GRCm39) missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92,840,335 (GRCm39) missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92,886,774 (GRCm39) nonsense probably null
R7095:Adamts9 UTSW 6 92,864,672 (GRCm39) missense probably benign 0.39
R7287:Adamts9 UTSW 6 92,866,984 (GRCm39) missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92,871,270 (GRCm39) missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92,835,102 (GRCm39) missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92,914,319 (GRCm39) missense probably benign 0.00
R7682:Adamts9 UTSW 6 92,857,679 (GRCm39) missense possibly damaging 0.57
R7791:Adamts9 UTSW 6 92,849,366 (GRCm39) missense probably benign 0.00
R7851:Adamts9 UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
R7974:Adamts9 UTSW 6 92,886,668 (GRCm39) critical splice donor site probably null
R8224:Adamts9 UTSW 6 92,773,351 (GRCm39) missense probably damaging 0.96
R8328:Adamts9 UTSW 6 92,866,993 (GRCm39) missense probably benign 0.17
R8334:Adamts9 UTSW 6 92,914,225 (GRCm39) splice site probably null
R8559:Adamts9 UTSW 6 92,784,117 (GRCm39) missense probably benign 0.01
R8709:Adamts9 UTSW 6 92,784,144 (GRCm39) missense probably damaging 1.00
R8735:Adamts9 UTSW 6 92,837,048 (GRCm39) intron probably benign
R8739:Adamts9 UTSW 6 92,831,261 (GRCm39) missense probably benign 0.04
R9108:Adamts9 UTSW 6 92,857,721 (GRCm39) missense probably damaging 1.00
R9171:Adamts9 UTSW 6 92,849,381 (GRCm39) missense probably benign 0.03
R9198:Adamts9 UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
R9299:Adamts9 UTSW 6 92,773,976 (GRCm39) missense probably benign 0.00
R9300:Adamts9 UTSW 6 92,864,371 (GRCm39) missense probably benign 0.10
R9308:Adamts9 UTSW 6 92,857,875 (GRCm39) missense probably benign 0.03
R9325:Adamts9 UTSW 6 92,849,279 (GRCm39) missense probably benign 0.00
R9397:Adamts9 UTSW 6 92,878,444 (GRCm39) missense probably damaging 1.00
R9550:Adamts9 UTSW 6 92,878,429 (GRCm39) missense probably benign 0.00
R9623:Adamts9 UTSW 6 92,857,661 (GRCm39) missense probably benign 0.02
R9698:Adamts9 UTSW 6 92,784,121 (GRCm39) missense probably damaging 1.00
R9755:Adamts9 UTSW 6 92,856,922 (GRCm39) missense probably benign 0.15
RF013:Adamts9 UTSW 6 92,920,126 (GRCm39) missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92,831,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCGTGGAGATAGCATTCTG -3'
(R):5'- ACTTGTGTTTCCTAGGTGAGCTAC -3'

Sequencing Primer
(F):5'- CCGTGGAGATAGCATTCTGGTAAG -3'
(R):5'- GTGAGCTACCCCAGAACTG -3'
Posted On 2019-11-12