Incidental Mutation 'R7691:Ssc5d'
ID593388
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Namescavenger receptor cysteine rich family, 5 domains
Synonymss5d-srcrb, A430110N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7691 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4925785-4944826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4944169 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1174 (T1174I)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
Predicted Effect probably benign
Transcript: ENSMUST00000057612
AA Change: T1174I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: T1174I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,796,238 C1763S probably damaging Het
Adcy3 T C 12: 4,206,540 V782A probably benign Het
Arhgef17 G A 7: 100,929,642 R700C probably damaging Het
Atxn2l T C 7: 126,492,610 probably null Het
Bach2 A G 4: 32,580,271 E832G probably damaging Het
Brpf3 G C 17: 28,806,831 A293P probably damaging Het
Cacfd1 T C 2: 27,010,094 L36P probably damaging Het
Camsap2 T C 1: 136,293,004 E268G probably damaging Het
Ccnjl A T 11: 43,583,201 Q201L probably benign Het
Cdan1 A G 2: 120,729,567 V372A probably damaging Het
Cenpf C A 1: 189,658,207 E1143* probably null Het
Colgalt1 A T 8: 71,620,754 M340L probably benign Het
Crybg3 A G 16: 59,556,134 Y1586H not run Het
Csmd3 A G 15: 47,741,173 I1058T Het
Dock1 G A 7: 135,138,157 probably null Het
Dzank1 G A 2: 144,506,171 T225I probably damaging Het
Eif3c G A 7: 126,551,990 R721W possibly damaging Het
Fdps A G 3: 89,099,367 V72A probably benign Het
Filip1l A G 16: 57,572,433 N1128S probably benign Het
Fmnl2 T A 2: 53,101,498 Y342N unknown Het
Gria1 A T 11: 57,236,987 I410F possibly damaging Het
Gsdmc4 C A 15: 63,893,791 S303I probably damaging Het
Herc2 C T 7: 56,191,845 P3491S probably benign Het
Hspb11 A G 4: 107,273,689 I59V probably benign Het
Lama2 T C 10: 27,208,393 H927R possibly damaging Het
Lrrc8e T C 8: 4,234,534 M253T probably damaging Het
Ltn1 G T 16: 87,398,686 H1317Q probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mki67 C T 7: 135,701,992 V716I not run Het
Mllt10 A G 2: 18,203,611 S694G possibly damaging Het
Mllt10 G C 2: 18,203,612 S694T probably null Het
Mtcl1 A G 17: 66,380,357 L518S probably damaging Het
Olfr1368 G A 13: 21,142,970 A29V probably benign Het
Pcdh10 G T 3: 45,381,197 D649Y probably damaging Het
Pdgfrb C T 18: 61,061,268 T39M probably benign Het
Pls1 T C 9: 95,773,673 E342G probably benign Het
Pon1 C T 6: 5,175,819 V235I probably benign Het
Rhobtb3 A T 13: 75,878,937 V439E probably damaging Het
Sept8 A G 11: 53,537,587 T355A probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sspo A T 6: 48,484,229 T3535S probably benign Het
Stk39 A G 2: 68,471,639 V80A probably damaging Het
Sult2b1 T C 7: 45,735,284 I123V probably benign Het
Sv2a A T 3: 96,188,411 I348F probably benign Het
Taar8b T A 10: 24,091,538 R253* probably null Het
Tbc1d4 T C 14: 101,507,641 K183R probably damaging Het
Tet2 T A 3: 133,486,849 D608V probably damaging Het
Tnfsf14 T A 17: 57,194,024 T16S possibly damaging Het
Togaram2 A G 17: 71,716,410 T774A probably benign Het
Tshr C A 12: 91,497,741 A87E probably benign Het
Tsn T C 1: 118,309,775 D53G probably benign Het
Usp37 TC T 1: 74,486,760 probably null Het
Vav2 T A 2: 27,297,738 probably null Het
Vmn2r52 T A 7: 10,159,182 I677F probably damaging Het
Vmn2r65 T A 7: 84,943,643 Y452F probably benign Het
Vmn2r79 A G 7: 87,037,903 R831G probably damaging Het
Zfp821 T C 8: 109,721,239 S71P probably damaging Het
Zwilch T A 9: 64,156,091 I286F probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4944481 missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4936281 missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4937112 nonsense probably null
IGL01409:Ssc5d APN 7 4942809 missense probably benign 0.16
IGL01880:Ssc5d APN 7 4933219 missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4943836 missense probably benign 0.00
IGL02227:Ssc5d APN 7 4933454 critical splice donor site probably null
IGL02963:Ssc5d APN 7 4944327 missense probably benign 0.02
D4043:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4936286 missense probably benign 0.41
R0115:Ssc5d UTSW 7 4927881 unclassified probably benign
R0201:Ssc5d UTSW 7 4944663 missense probably benign
R0365:Ssc5d UTSW 7 4928467 nonsense probably null
R0485:Ssc5d UTSW 7 4937471 missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4944343 nonsense probably null
R1607:Ssc5d UTSW 7 4944043 missense probably benign 0.25
R1639:Ssc5d UTSW 7 4928417 missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4936607 missense probably benign 0.05
R1867:Ssc5d UTSW 7 4928507 missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4942714 missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4928629 missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4937012 missense probably benign 0.01
R2234:Ssc5d UTSW 7 4943850 missense probably benign
R2259:Ssc5d UTSW 7 4943916 missense probably benign 0.01
R2567:Ssc5d UTSW 7 4936335 missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4936907 critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4942791 missense probably benign 0.00
R3875:Ssc5d UTSW 7 4927262 missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4928450 missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4942726 missense probably benign 0.00
R4334:Ssc5d UTSW 7 4943664 missense probably benign
R4430:Ssc5d UTSW 7 4943664 missense probably benign
R4619:Ssc5d UTSW 7 4929525 missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4943745 missense probably benign
R5106:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R5174:Ssc5d UTSW 7 4927971 missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4936290 missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4926518 critical splice donor site probably null
R5786:Ssc5d UTSW 7 4936818 missense probably benign 0.00
R6059:Ssc5d UTSW 7 4942744 missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4927254 missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4937522 missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R6613:Ssc5d UTSW 7 4933293 missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4936601 missense probably benign 0.17
R7576:Ssc5d UTSW 7 4928573 missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4942746 missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4927576 missense possibly damaging 0.56
R7759:Ssc5d UTSW 7 4937530 nonsense probably null
R8480:Ssc5d UTSW 7 4936329 missense probably damaging 1.00
X0063:Ssc5d UTSW 7 4936287 missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4928434 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCGTTTACAGCCTCTCAC -3'
(R):5'- AAGCTGAGTGTAAGGTCTGGC -3'

Sequencing Primer
(F):5'- GTTTACAGCCTCTCACCCCAC -3'
(R):5'- AGTGGGTCCAAGTTTGAGGC -3'
Posted On2019-11-12