Incidental Mutation 'R7691:Ssc5d'
ID 593388
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Name scavenger receptor cysteine rich family, 5 domains
Synonyms A430110N23Rik, s5d-srcrb
MMRRC Submission 045755-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7691 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 4928820-4947827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4947168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1174 (T1174I)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
AlphaFold Q8BV57
Predicted Effect probably benign
Transcript: ENSMUST00000057612
AA Change: T1174I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: T1174I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,773,219 (GRCm39) C1763S probably damaging Het
Adcy3 T C 12: 4,256,540 (GRCm39) V782A probably benign Het
Arhgef17 G A 7: 100,578,849 (GRCm39) R700C probably damaging Het
Atxn2l T C 7: 126,091,782 (GRCm39) probably null Het
Bach2 A G 4: 32,580,271 (GRCm39) E832G probably damaging Het
Brpf3 G C 17: 29,025,805 (GRCm39) A293P probably damaging Het
Cacfd1 T C 2: 26,900,106 (GRCm39) L36P probably damaging Het
Camsap2 T C 1: 136,220,742 (GRCm39) E268G probably damaging Het
Ccnjl A T 11: 43,474,028 (GRCm39) Q201L probably benign Het
Cdan1 A G 2: 120,560,048 (GRCm39) V372A probably damaging Het
Cenpf C A 1: 189,390,404 (GRCm39) E1143* probably null Het
Colgalt1 A T 8: 72,073,398 (GRCm39) M340L probably benign Het
Crybg3 A G 16: 59,376,497 (GRCm39) Y1586H not run Het
Csmd3 A G 15: 47,604,569 (GRCm39) I1058T Het
Dock1 G A 7: 134,739,886 (GRCm39) probably null Het
Dzank1 G A 2: 144,348,091 (GRCm39) T225I probably damaging Het
Eif3c G A 7: 126,151,162 (GRCm39) R721W possibly damaging Het
Fdps A G 3: 89,006,674 (GRCm39) V72A probably benign Het
Filip1l A G 16: 57,392,796 (GRCm39) N1128S probably benign Het
Fmnl2 T A 2: 52,991,510 (GRCm39) Y342N unknown Het
Gria1 A T 11: 57,127,813 (GRCm39) I410F possibly damaging Het
Gsdmc4 C A 15: 63,765,640 (GRCm39) S303I probably damaging Het
Herc2 C T 7: 55,841,593 (GRCm39) P3491S probably benign Het
Ift25 A G 4: 107,130,886 (GRCm39) I59V probably benign Het
Lama2 T C 10: 27,084,389 (GRCm39) H927R possibly damaging Het
Lrrc8e T C 8: 4,284,534 (GRCm39) M253T probably damaging Het
Ltn1 G T 16: 87,195,574 (GRCm39) H1317Q probably damaging Het
Map6 C T 7: 98,985,499 (GRCm39) L671F possibly damaging Het
Mki67 C T 7: 135,303,721 (GRCm39) V716I not run Het
Mllt10 G C 2: 18,208,423 (GRCm39) S694T probably null Het
Mllt10 A G 2: 18,208,422 (GRCm39) S694G possibly damaging Het
Mtcl1 A G 17: 66,687,352 (GRCm39) L518S probably damaging Het
Or2ad1 G A 13: 21,327,140 (GRCm39) A29V probably benign Het
Pcdh10 G T 3: 45,335,632 (GRCm39) D649Y probably damaging Het
Pdgfrb C T 18: 61,194,340 (GRCm39) T39M probably benign Het
Pls1 T C 9: 95,655,726 (GRCm39) E342G probably benign Het
Pon1 C T 6: 5,175,819 (GRCm39) V235I probably benign Het
Rhobtb3 A T 13: 76,027,056 (GRCm39) V439E probably damaging Het
Septin8 A G 11: 53,428,414 (GRCm39) T355A probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Sspo A T 6: 48,461,163 (GRCm39) T3535S probably benign Het
Stk39 A G 2: 68,301,983 (GRCm39) V80A probably damaging Het
Sult2b1 T C 7: 45,384,708 (GRCm39) I123V probably benign Het
Sv2a A T 3: 96,095,727 (GRCm39) I348F probably benign Het
Taar8b T A 10: 23,967,436 (GRCm39) R253* probably null Het
Tbc1d4 T C 14: 101,745,077 (GRCm39) K183R probably damaging Het
Tet2 T A 3: 133,192,610 (GRCm39) D608V probably damaging Het
Tnfsf14 T A 17: 57,501,024 (GRCm39) T16S possibly damaging Het
Togaram2 A G 17: 72,023,405 (GRCm39) T774A probably benign Het
Tshr C A 12: 91,464,515 (GRCm39) A87E probably benign Het
Tsn T C 1: 118,237,505 (GRCm39) D53G probably benign Het
Usp37 TC T 1: 74,525,919 (GRCm39) probably null Het
Vav2 T A 2: 27,187,750 (GRCm39) probably null Het
Vmn2r52 T A 7: 9,893,109 (GRCm39) I677F probably damaging Het
Vmn2r65 T A 7: 84,592,851 (GRCm39) Y452F probably benign Het
Vmn2r79 A G 7: 86,687,111 (GRCm39) R831G probably damaging Het
Zfp821 T C 8: 110,447,871 (GRCm39) S71P probably damaging Het
Zwilch T A 9: 64,063,373 (GRCm39) I286F probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4,947,480 (GRCm39) missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4,939,280 (GRCm39) missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4,940,111 (GRCm39) nonsense probably null
IGL01409:Ssc5d APN 7 4,945,808 (GRCm39) missense probably benign 0.16
IGL01880:Ssc5d APN 7 4,936,218 (GRCm39) missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4,946,835 (GRCm39) missense probably benign 0.00
IGL02227:Ssc5d APN 7 4,936,453 (GRCm39) critical splice donor site probably null
IGL02963:Ssc5d APN 7 4,947,326 (GRCm39) missense probably benign 0.02
D4043:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4,939,285 (GRCm39) missense probably benign 0.41
R0115:Ssc5d UTSW 7 4,930,880 (GRCm39) unclassified probably benign
R0201:Ssc5d UTSW 7 4,947,662 (GRCm39) missense probably benign
R0365:Ssc5d UTSW 7 4,931,466 (GRCm39) nonsense probably null
R0485:Ssc5d UTSW 7 4,940,470 (GRCm39) missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4,947,342 (GRCm39) nonsense probably null
R1607:Ssc5d UTSW 7 4,947,042 (GRCm39) missense probably benign 0.25
R1639:Ssc5d UTSW 7 4,931,416 (GRCm39) missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4,939,606 (GRCm39) missense probably benign 0.05
R1867:Ssc5d UTSW 7 4,931,506 (GRCm39) missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4,945,713 (GRCm39) missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4,931,628 (GRCm39) missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4,940,011 (GRCm39) missense probably benign 0.01
R2234:Ssc5d UTSW 7 4,946,849 (GRCm39) missense probably benign
R2259:Ssc5d UTSW 7 4,946,915 (GRCm39) missense probably benign 0.01
R2567:Ssc5d UTSW 7 4,939,334 (GRCm39) missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4,939,906 (GRCm39) critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4,945,790 (GRCm39) missense probably benign 0.00
R3875:Ssc5d UTSW 7 4,930,261 (GRCm39) missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4,931,449 (GRCm39) missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4,945,725 (GRCm39) missense probably benign 0.00
R4334:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4430:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4619:Ssc5d UTSW 7 4,932,524 (GRCm39) missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4,946,744 (GRCm39) missense probably benign
R5106:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R5174:Ssc5d UTSW 7 4,930,970 (GRCm39) missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4,939,289 (GRCm39) missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4,929,517 (GRCm39) critical splice donor site probably null
R5786:Ssc5d UTSW 7 4,939,817 (GRCm39) missense probably benign 0.00
R6059:Ssc5d UTSW 7 4,945,743 (GRCm39) missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4,930,253 (GRCm39) missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4,940,521 (GRCm39) missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R6613:Ssc5d UTSW 7 4,936,292 (GRCm39) missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4,939,600 (GRCm39) missense probably benign 0.17
R7576:Ssc5d UTSW 7 4,931,572 (GRCm39) missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4,945,745 (GRCm39) missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4,930,575 (GRCm39) missense possibly damaging 0.56
R7759:Ssc5d UTSW 7 4,940,529 (GRCm39) nonsense probably null
R8480:Ssc5d UTSW 7 4,939,328 (GRCm39) missense probably damaging 1.00
R9029:Ssc5d UTSW 7 4,930,919 (GRCm39) missense probably damaging 0.97
R9163:Ssc5d UTSW 7 4,936,432 (GRCm39) missense probably damaging 1.00
R9178:Ssc5d UTSW 7 4,930,058 (GRCm39) missense probably damaging 1.00
R9181:Ssc5d UTSW 7 4,945,814 (GRCm39) missense possibly damaging 0.86
R9382:Ssc5d UTSW 7 4,930,283 (GRCm39) critical splice donor site probably null
R9489:Ssc5d UTSW 7 4,940,599 (GRCm39) missense probably benign 0.02
R9626:Ssc5d UTSW 7 4,946,568 (GRCm39) missense probably benign
R9630:Ssc5d UTSW 7 4,939,426 (GRCm39) missense probably damaging 1.00
R9776:Ssc5d UTSW 7 4,932,367 (GRCm39) missense probably benign 0.07
X0063:Ssc5d UTSW 7 4,939,286 (GRCm39) missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4,931,433 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCGTTTACAGCCTCTCAC -3'
(R):5'- AAGCTGAGTGTAAGGTCTGGC -3'

Sequencing Primer
(F):5'- GTTTACAGCCTCTCACCCCAC -3'
(R):5'- AGTGGGTCCAAGTTTGAGGC -3'
Posted On 2019-11-12