Incidental Mutation 'R7691:Vmn2r79'
ID593393
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7691 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87037903 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 831 (R831G)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
AlphaFold E9Q067
Predicted Effect probably damaging
Transcript: ENSMUST00000164462
AA Change: R831G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: R831G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,796,238 C1763S probably damaging Het
Adcy3 T C 12: 4,206,540 V782A probably benign Het
Arhgef17 G A 7: 100,929,642 R700C probably damaging Het
Atxn2l T C 7: 126,492,610 probably null Het
Bach2 A G 4: 32,580,271 E832G probably damaging Het
Brpf3 G C 17: 28,806,831 A293P probably damaging Het
Cacfd1 T C 2: 27,010,094 L36P probably damaging Het
Camsap2 T C 1: 136,293,004 E268G probably damaging Het
Ccnjl A T 11: 43,583,201 Q201L probably benign Het
Cdan1 A G 2: 120,729,567 V372A probably damaging Het
Cenpf C A 1: 189,658,207 E1143* probably null Het
Colgalt1 A T 8: 71,620,754 M340L probably benign Het
Crybg3 A G 16: 59,556,134 Y1586H not run Het
Csmd3 A G 15: 47,741,173 I1058T Het
Dock1 G A 7: 135,138,157 probably null Het
Dzank1 G A 2: 144,506,171 T225I probably damaging Het
Eif3c G A 7: 126,551,990 R721W possibly damaging Het
Fdps A G 3: 89,099,367 V72A probably benign Het
Filip1l A G 16: 57,572,433 N1128S probably benign Het
Fmnl2 T A 2: 53,101,498 Y342N unknown Het
Gria1 A T 11: 57,236,987 I410F possibly damaging Het
Gsdmc4 C A 15: 63,893,791 S303I probably damaging Het
Herc2 C T 7: 56,191,845 P3491S probably benign Het
Hspb11 A G 4: 107,273,689 I59V probably benign Het
Lama2 T C 10: 27,208,393 H927R possibly damaging Het
Lrrc8e T C 8: 4,234,534 M253T probably damaging Het
Ltn1 G T 16: 87,398,686 H1317Q probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mki67 C T 7: 135,701,992 V716I not run Het
Mllt10 A G 2: 18,203,611 S694G possibly damaging Het
Mllt10 G C 2: 18,203,612 S694T probably null Het
Mtcl1 A G 17: 66,380,357 L518S probably damaging Het
Olfr1368 G A 13: 21,142,970 A29V probably benign Het
Pcdh10 G T 3: 45,381,197 D649Y probably damaging Het
Pdgfrb C T 18: 61,061,268 T39M probably benign Het
Pls1 T C 9: 95,773,673 E342G probably benign Het
Pon1 C T 6: 5,175,819 V235I probably benign Het
Rhobtb3 A T 13: 75,878,937 V439E probably damaging Het
Sept8 A G 11: 53,537,587 T355A probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Ssc5d C T 7: 4,944,169 T1174I probably benign Het
Sspo A T 6: 48,484,229 T3535S probably benign Het
Stk39 A G 2: 68,471,639 V80A probably damaging Het
Sult2b1 T C 7: 45,735,284 I123V probably benign Het
Sv2a A T 3: 96,188,411 I348F probably benign Het
Taar8b T A 10: 24,091,538 R253* probably null Het
Tbc1d4 T C 14: 101,507,641 K183R probably damaging Het
Tet2 T A 3: 133,486,849 D608V probably damaging Het
Tnfsf14 T A 17: 57,194,024 T16S possibly damaging Het
Togaram2 A G 17: 71,716,410 T774A probably benign Het
Tshr C A 12: 91,497,741 A87E probably benign Het
Tsn T C 1: 118,309,775 D53G probably benign Het
Usp37 TC T 1: 74,486,760 probably null Het
Vav2 T A 2: 27,297,738 probably null Het
Vmn2r52 T A 7: 10,159,182 I677F probably damaging Het
Vmn2r65 T A 7: 84,943,643 Y452F probably benign Het
Zfp821 T C 8: 109,721,239 S71P probably damaging Het
Zwilch T A 9: 64,156,091 I286F probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
PIT4445001:Vmn2r79 UTSW 7 87002200 missense possibly damaging 0.46
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense probably damaging 0.99
R7156:Vmn2r79 UTSW 7 87037643 missense probably damaging 0.98
R7604:Vmn2r79 UTSW 7 87003384 critical splice acceptor site probably null
R8055:Vmn2r79 UTSW 7 87037333 missense possibly damaging 0.94
R8070:Vmn2r79 UTSW 7 87002128 missense probably benign
R8073:Vmn2r79 UTSW 7 87002254 missense probably benign 0.00
R8145:Vmn2r79 UTSW 7 87037654 missense probably benign 0.02
R8263:Vmn2r79 UTSW 7 87037518 missense possibly damaging 0.89
R8350:Vmn2r79 UTSW 7 87037533 nonsense probably null
R8400:Vmn2r79 UTSW 7 87002100 missense probably benign 0.00
R8814:Vmn2r79 UTSW 7 87002506 missense probably benign 0.00
R8862:Vmn2r79 UTSW 7 86996504 missense probably benign 0.23
R9146:Vmn2r79 UTSW 7 87001473 nonsense probably null
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Z1176:Vmn2r79 UTSW 7 87002318 missense probably benign 0.00
Z1176:Vmn2r79 UTSW 7 87037169 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCAAGCTCCTGACATTCAG -3'
(R):5'- ATCCAATGGACTGATGGCC -3'

Sequencing Primer
(F):5'- CCTGACATTCAGCATGCTGGTG -3'
(R):5'- AGATCTATATTGTCCAGGAGGTTATC -3'
Posted On2019-11-12