Incidental Mutation 'R0240:Pcnx'
ID59340
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 038478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0240 (G1)
Quality Score162
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81947018 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 908 (I908T)
Ref Sequence ENSEMBL: ENSMUSP00000152104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021567
AA Change: I909T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: I909T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221675
AA Change: I275T
Predicted Effect possibly damaging
Transcript: ENSMUST00000221721
AA Change: I908T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,768,402 probably benign Het
Acsf3 T C 8: 122,780,181 L71P probably damaging Het
Adamts2 A T 11: 50,775,374 D399V probably damaging Het
Adck2 T A 6: 39,583,818 V380E probably benign Het
Alg11 T A 8: 22,065,452 V243D possibly damaging Het
Ankrd27 T A 7: 35,619,439 L585Q probably damaging Het
Atp7a T A X: 106,109,841 N1117K probably damaging Het
Cacna1b G A 2: 24,638,657 probably benign Het
Cacna1d T A 14: 30,096,969 M1210L probably benign Het
Cacna1s T C 1: 136,073,496 probably benign Het
Ccdc155 C T 7: 45,200,251 A83T probably benign Het
Chd7 T C 4: 8,852,670 probably benign Het
Col12a1 A T 9: 79,652,033 S1858T probably benign Het
Cotl1 C T 8: 119,840,324 W26* probably null Het
Csmd3 T C 15: 47,629,239 T3000A probably benign Het
Dcp1a T A 14: 30,484,594 probably benign Het
Ddhd2 A T 8: 25,739,590 probably null Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Dnm3 G T 1: 162,353,625 Q162K probably benign Het
Dpy19l2 G T 9: 24,658,580 A359D probably damaging Het
Ece1 T A 4: 137,949,435 probably benign Het
Eif4g3 A G 4: 138,170,562 K1025R probably damaging Het
Eml2 C A 7: 19,184,872 Y82* probably null Het
Eml6 A G 11: 29,792,367 V1057A possibly damaging Het
Eral1 A G 11: 78,076,058 probably benign Het
Espl1 T C 15: 102,312,541 S911P probably benign Het
Fbxo8 A G 8: 56,590,261 probably benign Het
Flrt1 A T 19: 7,097,110 probably benign Het
Fndc7 A G 3: 108,858,919 probably benign Het
G3bp1 G A 11: 55,492,028 G139D probably damaging Het
Gabra6 C T 11: 42,314,947 V351I probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Ganab A G 19: 8,912,813 D702G possibly damaging Het
Gm13762 A T 2: 88,973,396 L165Q probably damaging Het
Hdac10 T C 15: 89,125,882 E291G possibly damaging Het
Hectd3 T G 4: 117,002,613 V749G probably damaging Het
Kcnh1 T A 1: 192,505,340 I703N probably benign Het
Kcnma1 G A 14: 23,494,579 T505I probably damaging Het
Kctd11 A G 11: 69,879,814 C133R probably damaging Het
Lama3 A T 18: 12,539,823 probably null Het
Lamb3 T C 1: 193,335,027 L842P probably damaging Het
Ldlr T C 9: 21,737,999 probably benign Het
Lipk G A 19: 34,046,810 R336H probably benign Het
Lrrc24 T A 15: 76,723,209 D58V probably damaging Het
Lrsam1 A G 2: 32,955,185 L106P probably damaging Het
Milr1 G A 11: 106,754,896 W88* probably null Het
Mmp10 A G 9: 7,506,543 D340G probably damaging Het
Mybpc1 T A 10: 88,555,738 Y285F possibly damaging Het
Ncoa3 A G 2: 166,054,400 T408A probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nfasc A G 1: 132,601,983 S814P probably damaging Het
Nlrp4a T C 7: 26,462,516 V863A probably benign Het
Nos1 C T 5: 117,867,883 P223S probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1440 A T 19: 12,394,963 E233D probably benign Het
Olfr155 T A 4: 43,854,512 S68T probably damaging Het
Olfr228 A G 2: 86,483,386 S119P possibly damaging Het
Osbpl5 T C 7: 143,741,669 probably null Het
Otog C A 7: 46,264,032 probably null Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Pbx1 G A 1: 168,203,482 T189I possibly damaging Het
Pdxdc1 A T 16: 13,879,445 W124R probably damaging Het
Phex C A X: 157,186,218 D587Y probably damaging Het
Plcb3 A T 19: 6,962,995 D435E probably benign Het
Plce1 A C 19: 38,728,886 K1373T probably damaging Het
Prkcd G A 14: 30,602,088 A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 S421T probably benign Het
Ptprs T C 17: 56,436,087 probably null Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Rcc1 C A 4: 132,332,915 G393V probably damaging Het
Reln T C 5: 22,106,045 N290S probably benign Het
Rgl1 T C 1: 152,554,424 probably benign Het
Rhpn1 C T 15: 75,714,122 T628I probably benign Het
Rilp A G 11: 75,510,921 R176G probably benign Het
Riok3 C T 18: 12,155,227 A487V probably benign Het
Rnf224 T C 2: 25,236,207 T45A probably damaging Het
Rpa1 A G 11: 75,328,687 V137A probably benign Het
Rps6ka1 C A 4: 133,848,531 Q693H probably benign Het
Scn2a G T 2: 65,735,774 V1381F probably benign Het
Scp2 T A 4: 108,098,078 H112L probably benign Het
Sdk1 T C 5: 141,998,747 W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 V408F probably damaging Het
Slc28a2 T A 2: 122,454,527 I332N probably benign Het
Slc37a3 A G 6: 39,337,238 V480A probably benign Het
Slc45a4 T A 15: 73,581,906 E674D probably benign Het
Smpd3 T C 8: 106,265,156 E255G probably damaging Het
Snx29 C T 16: 11,660,553 R658W probably damaging Het
Sppl2a A T 2: 126,920,336 M275K probably benign Het
Stac T C 9: 111,635,021 N59S probably damaging Het
Stk25 A T 1: 93,627,060 L131Q probably damaging Het
Tep1 C T 14: 50,863,029 probably benign Het
Thbs1 C A 2: 118,114,393 N229K probably damaging Het
Tmx2 A T 2: 84,675,842 H89Q probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tradd T C 8: 105,259,292 N209S possibly damaging Het
Trappc3l A T 10: 34,098,932 R119* probably null Het
Trmt1l G A 1: 151,457,454 probably benign Het
Ublcp1 G T 11: 44,458,277 Y243* probably null Het
Uhrf1bp1 T A 17: 27,895,870 probably benign Het
Usp24 C A 4: 106,414,404 C2158* probably null Het
Usp34 A T 11: 23,433,206 K2088N probably damaging Het
Vmn1r53 G C 6: 90,223,943 S133C probably damaging Het
Vmn2r52 A G 7: 10,159,400 V604A probably damaging Het
Vmn2r93 A G 17: 18,304,799 K240E probably benign Het
Wdr13 T G X: 8,128,045 D242A probably damaging Het
Wwp1 C T 4: 19,641,734 probably null Het
Zan G A 5: 137,398,362 H4311Y unknown Het
Zc3h12c C A 9: 52,144,083 R123L possibly damaging Het
Zfp125 A T 12: 20,900,561 noncoding transcript Het
Zfp318 C T 17: 46,396,813 P266S probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- GATCACACACGCTGCCATTTTACC -3'
(R):5'- AGACAGTATGCGCTCCGACAAC -3'

Sequencing Primer
(F):5'- TCCCAAGTGCATGGAGATTG -3'
(R):5'- CAACTCATTTGAACAGGGTGC -3'
Posted On2013-07-11