Incidental Mutation 'R7691:Zwilch'
ID593403
Institutional Source Beutler Lab
Gene Symbol Zwilch
Ensembl Gene ENSMUSG00000032400
Gene Namezwilch kinetochore protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7691 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64137144-64173104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64156091 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 286 (I286F)
Ref Sequence ENSEMBL: ENSMUSP00000112790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122091] [ENSMUST00000176299] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000122091
AA Change: I286F

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400
AA Change: I286F

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
AA Change: I165F

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400
AA Change: I165F

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176794
AA Change: I262F

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400
AA Change: I262F

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177045
AA Change: I267F

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400
AA Change: I267F

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,796,238 C1763S probably damaging Het
Adcy3 T C 12: 4,206,540 V782A probably benign Het
Arhgef17 G A 7: 100,929,642 R700C probably damaging Het
Atxn2l T C 7: 126,492,610 probably null Het
Bach2 A G 4: 32,580,271 E832G probably damaging Het
Brpf3 G C 17: 28,806,831 A293P probably damaging Het
Cacfd1 T C 2: 27,010,094 L36P probably damaging Het
Camsap2 T C 1: 136,293,004 E268G probably damaging Het
Ccnjl A T 11: 43,583,201 Q201L probably benign Het
Cdan1 A G 2: 120,729,567 V372A probably damaging Het
Cenpf C A 1: 189,658,207 E1143* probably null Het
Colgalt1 A T 8: 71,620,754 M340L probably benign Het
Crybg3 A G 16: 59,556,134 Y1586H not run Het
Csmd3 A G 15: 47,741,173 I1058T Het
Dock1 G A 7: 135,138,157 probably null Het
Dzank1 G A 2: 144,506,171 T225I probably damaging Het
Eif3c G A 7: 126,551,990 R721W possibly damaging Het
Fdps A G 3: 89,099,367 V72A probably benign Het
Filip1l A G 16: 57,572,433 N1128S probably benign Het
Fmnl2 T A 2: 53,101,498 Y342N unknown Het
Gria1 A T 11: 57,236,987 I410F possibly damaging Het
Gsdmc4 C A 15: 63,893,791 S303I probably damaging Het
Herc2 C T 7: 56,191,845 P3491S probably benign Het
Hspb11 A G 4: 107,273,689 I59V probably benign Het
Lama2 T C 10: 27,208,393 H927R possibly damaging Het
Lrrc8e T C 8: 4,234,534 M253T probably damaging Het
Ltn1 G T 16: 87,398,686 H1317Q probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mki67 C T 7: 135,701,992 V716I not run Het
Mllt10 A G 2: 18,203,611 S694G possibly damaging Het
Mllt10 G C 2: 18,203,612 S694T probably null Het
Mtcl1 A G 17: 66,380,357 L518S probably damaging Het
Olfr1368 G A 13: 21,142,970 A29V probably benign Het
Pcdh10 G T 3: 45,381,197 D649Y probably damaging Het
Pdgfrb C T 18: 61,061,268 T39M probably benign Het
Pls1 T C 9: 95,773,673 E342G probably benign Het
Pon1 C T 6: 5,175,819 V235I probably benign Het
Rhobtb3 A T 13: 75,878,937 V439E probably damaging Het
Sept8 A G 11: 53,537,587 T355A probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Ssc5d C T 7: 4,944,169 T1174I probably benign Het
Sspo A T 6: 48,484,229 T3535S probably benign Het
Stk39 A G 2: 68,471,639 V80A probably damaging Het
Sult2b1 T C 7: 45,735,284 I123V probably benign Het
Sv2a A T 3: 96,188,411 I348F probably benign Het
Taar8b T A 10: 24,091,538 R253* probably null Het
Tbc1d4 T C 14: 101,507,641 K183R probably damaging Het
Tet2 T A 3: 133,486,849 D608V probably damaging Het
Tnfsf14 T A 17: 57,194,024 T16S possibly damaging Het
Togaram2 A G 17: 71,716,410 T774A probably benign Het
Tshr C A 12: 91,497,741 A87E probably benign Het
Tsn T C 1: 118,309,775 D53G probably benign Het
Usp37 TC T 1: 74,486,760 probably null Het
Vav2 T A 2: 27,297,738 probably null Het
Vmn2r52 T A 7: 10,159,182 I677F probably damaging Het
Vmn2r65 T A 7: 84,943,643 Y452F probably benign Het
Vmn2r79 A G 7: 87,037,903 R831G probably damaging Het
Zfp821 T C 8: 109,721,239 S71P probably damaging Het
Other mutations in Zwilch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Zwilch APN 9 64150267 missense probably damaging 1.00
IGL02365:Zwilch APN 9 64160924 missense probably damaging 1.00
IGL02733:Zwilch APN 9 64146836 missense probably benign 0.12
IGL02818:Zwilch APN 9 64150227 missense probably damaging 0.99
R1171:Zwilch UTSW 9 64158717 missense possibly damaging 0.56
R1913:Zwilch UTSW 9 64160952 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153574 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153575 missense probably damaging 1.00
R3772:Zwilch UTSW 9 64156034 missense probably benign 0.03
R4171:Zwilch UTSW 9 64158715 nonsense probably null
R4298:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4299:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4901:Zwilch UTSW 9 64162746 missense probably damaging 1.00
R5106:Zwilch UTSW 9 64153584 missense probably damaging 1.00
R5208:Zwilch UTSW 9 64152923 missense probably benign 0.00
R5215:Zwilch UTSW 9 64146874 missense probably benign
R5413:Zwilch UTSW 9 64168610 splice site probably null
R5865:Zwilch UTSW 9 64172908 start gained probably null
R6221:Zwilch UTSW 9 64161383 missense probably damaging 1.00
R6858:Zwilch UTSW 9 64153587 missense probably damaging 1.00
R6957:Zwilch UTSW 9 64162562 critical splice donor site probably null
R6995:Zwilch UTSW 9 64165449 nonsense probably null
R7104:Zwilch UTSW 9 64161376 missense probably damaging 1.00
R7595:Zwilch UTSW 9 64149264 intron probably benign
R7743:Zwilch UTSW 9 64152935 missense probably damaging 1.00
R8378:Zwilch UTSW 9 64152958 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCCAACCATATTAGATCACAGCTT -3'
(R):5'- AGGATCACATGTAGTTCCTGTGT -3'

Sequencing Primer
(F):5'- GCAAGCATATGCACTCAAT -3'
(R):5'- TGTAGCTCCATTGCCAGGAGATC -3'
Posted On2019-11-12