Incidental Mutation 'R0240:Kcnma1'
ID 59342
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Name potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms MaxiK, BKCa, 5730414M22Rik, BK channel alpha subunit, Slo, Slo1, mSlo1
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.856) question?
Stock # R0240 (G1)
Quality Score 92
Status Validated
Chromosome 14
Chromosomal Location 23342356-24055173 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 23544647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 505 (T505I)
Ref Sequence ENSEMBL: ENSMUSP00000153083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000188285] [ENSMUST00000188210] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000224232] [ENSMUST00000223749] [ENSMUST00000224787] [ENSMUST00000223655] [ENSMUST00000224812] [ENSMUST00000223727] [ENSMUST00000224285] [ENSMUST00000224077] [ENSMUST00000224468] [ENSMUST00000179836] [ENSMUST00000225315] [ENSMUST00000225471] [ENSMUST00000225431] [ENSMUST00000225794] [ENSMUST00000225556] [ENSMUST00000226051]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065788
AA Change: T445I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074983
AA Change: T445I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100831
AA Change: T445I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112423
AA Change: T391I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: T391I

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145596
AA Change: T570I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: T445I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172099
AA Change: T445I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177634
AA Change: T445I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179097
AA Change: T445I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: T445I

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188285
AA Change: T570I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: T570I

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188210
AA Change: T505I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: T505I

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188991
AA Change: T570I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: T570I

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190044
AA Change: T570I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: T570I

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190985
AA Change: T505I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212542
Predicted Effect unknown
Transcript: ENSMUST00000224025
AA Change: T520I
Predicted Effect probably damaging
Transcript: ENSMUST00000224232
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223749
AA Change: T505I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224787
AA Change: T451I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000223655
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224812
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223727
AA Change: T505I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224077
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224468
AA Change: T570I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000179836
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224933
Predicted Effect probably damaging
Transcript: ENSMUST00000225315
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225471
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225431
AA Change: T505I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Predicted Effect probably benign
Transcript: ENSMUST00000225556
Predicted Effect probably benign
Transcript: ENSMUST00000226051
Meta Mutation Damage Score 0.8931 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Col12a1 A T 9: 79,559,315 (GRCm39) S1858T probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Dpy19l2 G T 9: 24,569,876 (GRCm39) A359D probably damaging Het
Ece1 T A 4: 137,676,746 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lama3 A T 18: 12,672,880 (GRCm39) probably null Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Plce1 A C 19: 38,717,330 (GRCm39) K1373T probably damaging Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23,364,390 (GRCm39) splice site probably benign
IGL01520:Kcnma1 APN 14 23,551,211 (GRCm39) missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23,580,367 (GRCm39) splice site probably benign
IGL02140:Kcnma1 APN 14 23,359,113 (GRCm39) missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23,387,035 (GRCm39) missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23,576,881 (GRCm39) missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23,593,144 (GRCm39) missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23,641,681 (GRCm39) missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23,641,681 (GRCm39) missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23,361,757 (GRCm39) missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23,436,327 (GRCm39) critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23,413,900 (GRCm39) missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23,513,224 (GRCm39) missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23,359,222 (GRCm39) missense probably damaging 1.00
G1citation:Kcnma1 UTSW 14 24,053,812 (GRCm39) splice site probably null
PIT4495001:Kcnma1 UTSW 14 23,475,665 (GRCm39) missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
PIT4576001:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
R0071:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23,364,243 (GRCm39) missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23,853,234 (GRCm39) missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23,576,835 (GRCm39) missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23,558,120 (GRCm39) missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23,544,647 (GRCm39) missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23,423,265 (GRCm39) missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23,361,784 (GRCm39) missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23,559,852 (GRCm39) splice site probably benign
R0668:Kcnma1 UTSW 14 23,417,563 (GRCm39) missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23,544,675 (GRCm39) missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23,417,710 (GRCm39) missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23,361,792 (GRCm39) missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23,513,268 (GRCm39) missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23,364,262 (GRCm39) missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23,380,997 (GRCm39) missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23,853,230 (GRCm39) missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23,387,097 (GRCm39) missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23,364,288 (GRCm39) missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23,593,151 (GRCm39) nonsense probably null
R2866:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23,423,275 (GRCm39) missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23,853,228 (GRCm39) missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23,350,006 (GRCm39) missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23,417,679 (GRCm39) missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23,555,323 (GRCm39) missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24,053,815 (GRCm39) critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24,053,815 (GRCm39) critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23,361,720 (GRCm39) missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23,387,097 (GRCm39) missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23,853,228 (GRCm39) missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23,359,106 (GRCm39) critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23,853,270 (GRCm39) missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23,413,904 (GRCm39) missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23,359,220 (GRCm39) missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24,054,186 (GRCm39) intron probably benign
R5175:Kcnma1 UTSW 14 23,386,106 (GRCm39) critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23,513,253 (GRCm39) missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23,578,472 (GRCm39) nonsense probably null
R5705:Kcnma1 UTSW 14 24,053,839 (GRCm39) missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23,544,635 (GRCm39) missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23,436,419 (GRCm39) nonsense probably null
R5793:Kcnma1 UTSW 14 23,359,103 (GRCm39) splice site probably null
R6039:Kcnma1 UTSW 14 23,359,105 (GRCm39) missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23,359,105 (GRCm39) missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24,053,936 (GRCm39) missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23,559,957 (GRCm39) missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23,386,165 (GRCm39) missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24,052,882 (GRCm39) nonsense probably null
R6822:Kcnma1 UTSW 14 24,053,812 (GRCm39) splice site probably null
R6855:Kcnma1 UTSW 14 23,417,679 (GRCm39) missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23,576,602 (GRCm39) critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23,544,711 (GRCm39) missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23,350,086 (GRCm39) missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23,513,224 (GRCm39) missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23,417,562 (GRCm39) missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23,576,691 (GRCm39) missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23,359,083 (GRCm39) makesense probably null
R7308:Kcnma1 UTSW 14 23,381,003 (GRCm39) missense probably damaging 0.99
R7371:Kcnma1 UTSW 14 23,544,638 (GRCm39) missense possibly damaging 0.94
R7404:Kcnma1 UTSW 14 24,052,902 (GRCm39) missense unknown
R7560:Kcnma1 UTSW 14 23,580,310 (GRCm39) missense probably benign 0.15
R7693:Kcnma1 UTSW 14 23,417,680 (GRCm39) missense probably damaging 1.00
R7763:Kcnma1 UTSW 14 23,350,074 (GRCm39) missense possibly damaging 0.66
R7809:Kcnma1 UTSW 14 23,423,324 (GRCm39) missense probably benign 0.16
R7832:Kcnma1 UTSW 14 23,440,991 (GRCm39) missense probably benign
R7884:Kcnma1 UTSW 14 23,387,057 (GRCm39) missense probably benign 0.01
R8013:Kcnma1 UTSW 14 23,423,211 (GRCm39) missense probably benign 0.31
R8014:Kcnma1 UTSW 14 23,423,211 (GRCm39) missense probably benign 0.31
R8066:Kcnma1 UTSW 14 23,361,744 (GRCm39) missense probably benign 0.00
R8097:Kcnma1 UTSW 14 23,381,032 (GRCm39) missense probably damaging 1.00
R8154:Kcnma1 UTSW 14 23,361,822 (GRCm39) missense possibly damaging 0.62
R8507:Kcnma1 UTSW 14 23,641,706 (GRCm39) missense probably benign 0.00
R8672:Kcnma1 UTSW 14 23,551,230 (GRCm39) missense probably damaging 1.00
R8677:Kcnma1 UTSW 14 23,436,418 (GRCm39) missense probably benign 0.36
R8725:Kcnma1 UTSW 14 23,436,332 (GRCm39) missense probably benign 0.00
R8727:Kcnma1 UTSW 14 23,436,332 (GRCm39) missense probably benign 0.00
R8827:Kcnma1 UTSW 14 23,417,548 (GRCm39) missense probably damaging 1.00
R8880:Kcnma1 UTSW 14 23,417,718 (GRCm39) missense probably damaging 1.00
R8997:Kcnma1 UTSW 14 23,513,037 (GRCm39) intron probably benign
R9056:Kcnma1 UTSW 14 23,700,214 (GRCm39) missense possibly damaging 0.80
R9346:Kcnma1 UTSW 14 23,700,233 (GRCm39) missense possibly damaging 0.94
R9403:Kcnma1 UTSW 14 23,593,145 (GRCm39) missense probably benign 0.05
R9438:Kcnma1 UTSW 14 23,417,653 (GRCm39) missense probably benign 0.00
R9482:Kcnma1 UTSW 14 23,441,033 (GRCm39) missense probably benign
R9511:Kcnma1 UTSW 14 23,361,793 (GRCm39) missense possibly damaging 0.90
R9649:Kcnma1 UTSW 14 23,501,666 (GRCm39) critical splice donor site probably null
R9663:Kcnma1 UTSW 14 24,053,897 (GRCm39) missense probably benign 0.15
R9673:Kcnma1 UTSW 14 23,558,123 (GRCm39) missense probably benign 0.01
RF001:Kcnma1 UTSW 14 23,361,765 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAGTTAAAGCCCGTCGTTCTG -3'
(R):5'- TGTTGCCAAGAAGCCCAAGTCTG -3'

Sequencing Primer
(F):5'- AAAGCCCGTCGTTCTGTTTTG -3'
(R):5'- TGGACTATGCAGCAATTCCAAG -3'
Posted On 2013-07-11