Incidental Mutation 'R7691:Togaram2'
ID593423
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7691 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71716410 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 774 (T774A)
Ref Sequence ENSEMBL: ENSMUSP00000114359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
AA Change: T754A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: T754A

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144479
AA Change: T774A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: T774A

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
AA Change: T754A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: T754A

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,796,238 C1763S probably damaging Het
Adcy3 T C 12: 4,206,540 V782A probably benign Het
Arhgef17 G A 7: 100,929,642 R700C probably damaging Het
Atxn2l T C 7: 126,492,610 probably null Het
Bach2 A G 4: 32,580,271 E832G probably damaging Het
Brpf3 G C 17: 28,806,831 A293P probably damaging Het
Cacfd1 T C 2: 27,010,094 L36P probably damaging Het
Camsap2 T C 1: 136,293,004 E268G probably damaging Het
Ccnjl A T 11: 43,583,201 Q201L probably benign Het
Cdan1 A G 2: 120,729,567 V372A probably damaging Het
Cenpf C A 1: 189,658,207 E1143* probably null Het
Colgalt1 A T 8: 71,620,754 M340L probably benign Het
Crybg3 A G 16: 59,556,134 Y1586H not run Het
Csmd3 A G 15: 47,741,173 I1058T Het
Dock1 G A 7: 135,138,157 probably null Het
Dzank1 G A 2: 144,506,171 T225I probably damaging Het
Eif3c G A 7: 126,551,990 R721W possibly damaging Het
Fdps A G 3: 89,099,367 V72A probably benign Het
Filip1l A G 16: 57,572,433 N1128S probably benign Het
Fmnl2 T A 2: 53,101,498 Y342N unknown Het
Gria1 A T 11: 57,236,987 I410F possibly damaging Het
Gsdmc4 C A 15: 63,893,791 S303I probably damaging Het
Herc2 C T 7: 56,191,845 P3491S probably benign Het
Hspb11 A G 4: 107,273,689 I59V probably benign Het
Lama2 T C 10: 27,208,393 H927R possibly damaging Het
Lrrc8e T C 8: 4,234,534 M253T probably damaging Het
Ltn1 G T 16: 87,398,686 H1317Q probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mki67 C T 7: 135,701,992 V716I not run Het
Mllt10 A G 2: 18,203,611 S694G possibly damaging Het
Mllt10 G C 2: 18,203,612 S694T probably null Het
Mtcl1 A G 17: 66,380,357 L518S probably damaging Het
Olfr1368 G A 13: 21,142,970 A29V probably benign Het
Pcdh10 G T 3: 45,381,197 D649Y probably damaging Het
Pdgfrb C T 18: 61,061,268 T39M probably benign Het
Pls1 T C 9: 95,773,673 E342G probably benign Het
Pon1 C T 6: 5,175,819 V235I probably benign Het
Rhobtb3 A T 13: 75,878,937 V439E probably damaging Het
Sept8 A G 11: 53,537,587 T355A probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Ssc5d C T 7: 4,944,169 T1174I probably benign Het
Sspo A T 6: 48,484,229 T3535S probably benign Het
Stk39 A G 2: 68,471,639 V80A probably damaging Het
Sult2b1 T C 7: 45,735,284 I123V probably benign Het
Sv2a A T 3: 96,188,411 I348F probably benign Het
Taar8b T A 10: 24,091,538 R253* probably null Het
Tbc1d4 T C 14: 101,507,641 K183R probably damaging Het
Tet2 T A 3: 133,486,849 D608V probably damaging Het
Tnfsf14 T A 17: 57,194,024 T16S possibly damaging Het
Tshr C A 12: 91,497,741 A87E probably benign Het
Tsn T C 1: 118,309,775 D53G probably benign Het
Usp37 TC T 1: 74,486,760 probably null Het
Vav2 T A 2: 27,297,738 probably null Het
Vmn2r52 T A 7: 10,159,182 I677F probably damaging Het
Vmn2r65 T A 7: 84,943,643 Y452F probably benign Het
Vmn2r79 A G 7: 87,037,903 R831G probably damaging Het
Zfp821 T C 8: 109,721,239 S71P probably damaging Het
Zwilch T A 9: 64,156,091 I286F probably benign Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4066:Togaram2 UTSW 17 71716238 intron probably benign
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71689209 missense probably benign 0.00
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6682:Togaram2 UTSW 17 71704754 missense probably benign 0.04
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7015:Togaram2 UTSW 17 71709568 missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
R7383:Togaram2 UTSW 17 71700517 missense probably damaging 1.00
R7778:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7824:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7862:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7864:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
R7945:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7947:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 71701002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGTCCTACCTGGCAGTG -3'
(R):5'- CATCTGAAAAGTGAGTGCTTAGGG -3'

Sequencing Primer
(F):5'- TCCTACCTGGCAGTGGGATG -3'
(R):5'- AGTTCTGAGCTCTCCAGATCAAG -3'
Posted On2019-11-12