Incidental Mutation 'R7692:Smarcal1'
ID593426
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene NameSWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms6030401P21Rik, Mharp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72583251-72633134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72586020 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 109 (S109A)
Ref Sequence ENSEMBL: ENSMUSP00000047589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000145868] [ENSMUST00000152225]
PDB Structure Crystal Structure of SMARCAL1 HARP substrate recognition domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000047615
AA Change: S109A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: S109A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133123
SMART Domains Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 66 106 1.7e-14 PFAM
Pfam:HARP 140 194 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145868
SMART Domains Protein: ENSMUSP00000120230
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152225
AA Change: S109A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: S109A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72616565 missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72586131 missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72616520 nonsense probably null
IGL02007:Smarcal1 APN 1 72595940 missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72633055 utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72620088 missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72598935 splice site probably null
IGL03135:Smarcal1 APN 1 72616501 splice site probably null
IGL03306:Smarcal1 APN 1 72626466 missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72632851 missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72595811 nonsense probably null
R0396:Smarcal1 UTSW 1 72626473 missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72598856 missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72585961 missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72586099 missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72626689 intron probably benign
R4438:Smarcal1 UTSW 1 72611478 intron probably benign
R4722:Smarcal1 UTSW 1 72611337 missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72597440 missense probably benign
R4989:Smarcal1 UTSW 1 72632860 missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72591083 missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72595976 critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72598909 missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72626617 missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72591253 missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72586213 missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72591137 missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72616557 missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72585874 missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72591173 missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72612942 missense probably damaging 1.00
R7975:Smarcal1 UTSW 1 72612991 missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72626563 missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72601395 missense probably benign 0.04
R8901:Smarcal1 UTSW 1 72585780 missense possibly damaging 0.71
Z1177:Smarcal1 UTSW 1 72591267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCAGAACAGCCACAGAGC -3'
(R):5'- GTCCGAAATGCTCTGCCTAG -3'

Sequencing Primer
(F):5'- AAGCAGGGCTCTCTCCTGAATC -3'
(R):5'- CTAGAGGTGGAAGGCCTTGC -3'
Posted On2019-11-12