Mutagenetix > Incidental Mutation

Incidental Mutation 'R7692:Smarcal1'

593426

Institutional Source

Beutler Lab

Gene Symbol

Smarcal1

Ensembl Gene

ENSMUSG00000039354

Gene Name

SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1

Synonyms

6030401P21Rik, Mharp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7692 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72583251-72633134 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72586020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 109 (S109A)

Ref Sequence

ENSEMBL: ENSMUSP00000047589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000145868] [ENSMUST00000152225]

AlphaFold

Q8BJL0

PDB Structure

Crystal Structure of SMARCAL1 HARP substrate recognition domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000047615
AA Change: S109A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: S109A

Domain	Start	End	E-Value	Type
low complexity region	31	51	N/A	INTRINSIC
Pfam:HARP	214	268	3.6e-26	PFAM
Pfam:HARP	302	356	1.2e-26	PFAM
DEXDc	391	564	7.01e-17	SMART
low complexity region	632	641	N/A	INTRINSIC
HELICc	697	780	8.17e-18	SMART
low complexity region	879	889	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133123

SMART Domains

Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354

Domain	Start	End	E-Value	Type
low complexity region	31	51	N/A	INTRINSIC
Pfam:HARP	66	106	1.7e-14	PFAM
Pfam:HARP	140	194	2.2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145868

SMART Domains

Protein: ENSMUSP00000120230
Gene: ENSMUSG00000039354

Domain	Start	End	E-Value	Type
low complexity region	31	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152225
AA Change: S109A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: S109A

Domain	Start	End	E-Value	Type
low complexity region	31	51	N/A	INTRINSIC
Pfam:HARP	214	268	8e-29	PFAM
Pfam:HARP	302	356	3e-26	PFAM
DEXDc	391	564	7.01e-17	SMART
low complexity region	632	641	N/A	INTRINSIC
HELICc	697	780	8.17e-18	SMART
low complexity region	879	889	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,520,795	T390I	probably benign	Het
Adgb	A	G	10: 10,411,712		probably null	Het
Ado	G	T	10: 67,548,435	Y113*	probably null	Het
Angptl1	A	G	1: 156,845,315	E237G	probably damaging	Het
Arid2	T	A	15: 96,356,697	Y141*	probably null	Het
Clvs1	T	C	4: 9,350,739	I183T	probably benign	Het
Dnah1	T	C	14: 31,292,338	K1817E	probably benign	Het
Eif3e	C	A	15: 43,263,246	R271L	probably damaging	Het
Eml6	A	G	11: 29,753,085	V1611A	probably damaging	Het
Enpp3	G	T	10: 24,784,841	Y634*	probably null	Het
Evi5l	C	T	8: 4,200,886	R394W	probably damaging	Het
Fcgr3	A	C	1: 171,054,092	F156V	probably damaging	Het
Fmo1	T	A	1: 162,833,833	T294S	probably benign	Het
Gabrb3	A	G	7: 57,816,455	Q339R	probably damaging	Het
Gen1	T	A	12: 11,242,166	T606S	probably benign	Het
Gfod1	T	C	13: 43,201,052	Q149R	probably benign	Het
Golm1	A	G	13: 59,640,257	V276A	probably benign	Het
Hc	C	A	2: 35,024,149	V849F	probably damaging	Het
Hectd4	T	C	5: 121,321,564	I832T	possibly damaging	Het
Hspa14	T	C	2: 3,496,606	D283G	probably damaging	Het
Lztfl1	C	T	9: 123,712,471	W94*	probably null	Het
Lzts3	T	C	2: 130,635,386	S381G	probably benign	Het
Mgat2	A	G	12: 69,184,670	Y6C	probably damaging	Het
Mrpl30	T	C	1: 37,895,358	I27T	probably benign	Het
Muc5b	A	T	7: 141,853,229	T1045S	unknown	Het
Nlrp4a	G	A	7: 26,449,265	R99Q	probably benign	Het
Olfr1450	A	G	19: 12,953,642	T18A	possibly damaging	Het
Olfr1510	T	C	14: 52,410,488	Y128C	probably damaging	Het
Phlpp1	T	C	1: 106,281,402	L495P	probably damaging	Het
Pla2g4d	T	C	2: 120,279,295	D178G	possibly damaging	Het
Prl5a1	C	G	13: 28,150,014	L167V	probably damaging	Het
Sardh	A	G	2: 27,197,639	V740A	probably benign	Het
Sbno1	T	G	5: 124,405,646	T277P	probably benign	Het
Slc2a1	T	C	4: 119,136,265	V433A	probably damaging	Het
Slc4a10	T	C	2: 62,303,964	V1008A	possibly damaging	Het
Speg	A	G	1: 75,401,190	D864G	probably benign	Het
Steap4	T	C	5: 7,976,976	I313T	probably benign	Het
Tab2	A	T	10: 7,911,105	D614E	probably damaging	Het
Tenm4	A	G	7: 96,895,403	K2246E	probably damaging	Het
Timm23	A	G	14: 32,180,563	S208P	probably damaging	Het
Tmem229a	C	A	6: 24,955,212	C181F	probably benign	Het
Ugdh	T	C	5: 65,417,615	Y356C	probably damaging	Het
Ugt2a1	A	G	5: 87,486,727	L7P	probably damaging	Het
Uhrf1	A	G	17: 56,312,905	D272G	possibly damaging	Het
Vmn1r206	T	A	13: 22,620,657	I127F	probably damaging	Het
Vmn2r106	T	C	17: 20,285,228	Y68C	possibly damaging	Het
Zfand6	G	A	7: 84,633,933	P72L	not run	Het

Other mutations in Smarcal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Smarcal1	APN	1	72616565	missense	possibly damaging	0.80
IGL01658:Smarcal1	APN	1	72586131	missense	probably benign	0.00
IGL01980:Smarcal1	APN	1	72616520	nonsense	probably null
IGL02007:Smarcal1	APN	1	72595940	missense	probably damaging	0.98
IGL02153:Smarcal1	APN	1	72633055	utr 3 prime	probably benign
IGL02496:Smarcal1	APN	1	72620088	missense	probably damaging	1.00
IGL03084:Smarcal1	APN	1	72598935	splice site	probably null
IGL03135:Smarcal1	APN	1	72616501	splice site	probably null
IGL03306:Smarcal1	APN	1	72626466	missense	probably benign	0.12
R0133:Smarcal1	UTSW	1	72632851	missense	probably benign	0.05
R0315:Smarcal1	UTSW	1	72595811	nonsense	probably null
R0396:Smarcal1	UTSW	1	72626473	missense	probably benign	0.03
R0891:Smarcal1	UTSW	1	72598856	missense	probably damaging	0.99
R1799:Smarcal1	UTSW	1	72585961	missense	probably damaging	0.97
R1854:Smarcal1	UTSW	1	72586099	missense	possibly damaging	0.77
R3725:Smarcal1	UTSW	1	72626596	missense	possibly damaging	0.88
R3726:Smarcal1	UTSW	1	72626596	missense	possibly damaging	0.88
R4164:Smarcal1	UTSW	1	72626689	intron	probably benign
R4438:Smarcal1	UTSW	1	72611478	intron	probably benign
R4722:Smarcal1	UTSW	1	72611337	missense	probably damaging	1.00
R4796:Smarcal1	UTSW	1	72597440	missense	probably benign
R4989:Smarcal1	UTSW	1	72632860	missense	possibly damaging	0.84
R5242:Smarcal1	UTSW	1	72591083	missense	probably benign	0.00
R5367:Smarcal1	UTSW	1	72595976	critical splice donor site	probably null
R5418:Smarcal1	UTSW	1	72598909	missense	probably benign	0.01
R5430:Smarcal1	UTSW	1	72626617	missense	probably damaging	1.00
R5591:Smarcal1	UTSW	1	72591253	missense	probably damaging	1.00
R5607:Smarcal1	UTSW	1	72586213	missense	probably benign	0.00
R5809:Smarcal1	UTSW	1	72591137	missense	probably benign	0.09
R6395:Smarcal1	UTSW	1	72616557	missense	possibly damaging	0.82
R6447:Smarcal1	UTSW	1	72585874	missense	probably damaging	0.96
R6852:Smarcal1	UTSW	1	72591173	missense	possibly damaging	0.75
R7060:Smarcal1	UTSW	1	72612942	missense	probably damaging	1.00
R7975:Smarcal1	UTSW	1	72612991	missense	probably benign	0.08
R8232:Smarcal1	UTSW	1	72626563	missense	probably damaging	1.00
R8407:Smarcal1	UTSW	1	72601395	missense	probably benign	0.04
R8901:Smarcal1	UTSW	1	72585780	missense	possibly damaging	0.71
R9329:Smarcal1	UTSW	1	72626538	missense	probably damaging	0.99
R9548:Smarcal1	UTSW	1	72632840	missense	possibly damaging	0.84
Z1177:Smarcal1	UTSW	1	72591267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCAGAACAGCCACAGAGC -3'
(R):5'- GTCCGAAATGCTCTGCCTAG -3'

Sequencing Primer
(F):5'- AAGCAGGGCTCTCTCCTGAATC -3'
(R):5'- CTAGAGGTGGAAGGCCTTGC -3'

Posted On

2019-11-12