Incidental Mutation 'R7692:Angptl1'
ID593429
Institutional Source Beutler Lab
Gene Symbol Angptl1
Ensembl Gene ENSMUSG00000033544
Gene Nameangiopoietin-like 1
SynonymsANGPT3, ANG-3, ANG3, 2810039D03Rik, ANGY, ARP1, ANG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156838562-156861078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156845315 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 237 (E237G)
Ref Sequence ENSEMBL: ENSMUSP00000027885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027885] [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000111720] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably damaging
Transcript: ENSMUST00000027885
AA Change: E237G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027885
Gene: ENSMUSG00000033544
AA Change: E237G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FBG 274 489 1.3e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027886
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063199
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111720
AA Change: E237G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107349
Gene: ENSMUSG00000033544
AA Change: E237G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171292
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172057
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185198
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188656
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189316
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190648
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191605
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no detectable phenotypic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Angptl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02835:Angptl1 UTSW 1 156858520 missense probably benign 0.22
R0285:Angptl1 UTSW 1 156845215 missense probably benign 0.00
R1237:Angptl1 UTSW 1 156858584 missense probably damaging 1.00
R1573:Angptl1 UTSW 1 156857170 missense possibly damaging 0.81
R1722:Angptl1 UTSW 1 156857085 missense possibly damaging 0.87
R4621:Angptl1 UTSW 1 156844924 missense probably damaging 1.00
R4795:Angptl1 UTSW 1 156860583 missense possibly damaging 0.88
R4849:Angptl1 UTSW 1 156857165 missense probably benign 0.01
R4915:Angptl1 UTSW 1 156844818 missense probably benign
R5919:Angptl1 UTSW 1 156858546 missense probably damaging 1.00
R6656:Angptl1 UTSW 1 156857236 missense probably damaging 1.00
R6833:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R6834:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R7453:Angptl1 UTSW 1 156844851 missense probably benign 0.06
R7657:Angptl1 UTSW 1 156857220 missense probably benign 0.01
R8765:Angptl1 UTSW 1 156857157 missense probably benign 0.01
RF002:Angptl1 UTSW 1 156857224 missense possibly damaging 0.79
X0066:Angptl1 UTSW 1 156844935 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTGAAGTATGCGTCCTTGAC -3'
(R):5'- GACATGTATAATGGCATCAGCAC -3'

Sequencing Primer
(F):5'- GACGGATCTTGTCAATAACCAGTCTG -3'
(R):5'- GAGTATTGTTGCGTGAATCATACAGC -3'
Posted On2019-11-12