Incidental Mutation 'R7692:Fcgr3'
ID593431
Institutional Source Beutler Lab
Gene Symbol Fcgr3
Ensembl Gene ENSMUSG00000059498
Gene NameFc receptor, IgG, low affinity III
SynonymsCD16, FcgammaRIII, Fcg receptor III
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171051174-171064935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 171054092 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 156 (F156V)
Ref Sequence ENSEMBL: ENSMUSP00000131938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164044] [ENSMUST00000164179] [ENSMUST00000169017]
Predicted Effect probably damaging
Transcript: ENSMUST00000164044
AA Change: F156V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131938
Gene: ENSMUSG00000059498
AA Change: F156V

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 47 120 1.2e-1 SMART
IG 128 206 1.24e-8 SMART
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164179
SMART Domains Protein: ENSMUSP00000133039
Gene: ENSMUSG00000059498

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
PDB:3WJL|C 35 74 6e-11 PDB
SCOP:d1f2qa1 39 74 8e-7 SMART
Blast:IG 46 74 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169017
AA Change: F155V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131836
Gene: ENSMUSG00000059498
AA Change: F155V

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 46 119 1.2e-1 SMART
IG 127 205 1.24e-8 SMART
transmembrane domain 218 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack IgG-mediated mast cell degranulation and have impaired IgG-dependent anaphylaxis and Arthus reactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Fcgr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Fcgr3 APN 1 171059280 missense probably damaging 1.00
PIT4696001:Fcgr3 UTSW 1 171057750 missense probably damaging 1.00
R1722:Fcgr3 UTSW 1 171054119 missense possibly damaging 0.89
R3734:Fcgr3 UTSW 1 171057874 missense probably benign 0.04
R4207:Fcgr3 UTSW 1 171054075 missense probably benign 0.29
R5885:Fcgr3 UTSW 1 171057711 missense probably damaging 1.00
R7237:Fcgr3 UTSW 1 171059301 missense probably damaging 1.00
R7429:Fcgr3 UTSW 1 171057873 missense probably benign
R7514:Fcgr3 UTSW 1 171059343 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATAGCAGCTCACCTTGGAC -3'
(R):5'- GAGATAGCTACAGCACTTGGG -3'

Sequencing Primer
(F):5'- AGCTCACCTTGGACAGTGATG -3'
(R):5'- TGGAACTCCTCTGTAGACCAG -3'
Posted On2019-11-12