Incidental Mutation 'R7692:Hspa14'
ID593432
Institutional Source Beutler Lab
Gene Symbol Hspa14
Ensembl Gene ENSMUSG00000109865
Gene Nameheat shock protein 14
SynonymsHsp70-4, 70kDa, NST-1, HSP70L1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location3488850-3512814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3496606 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 283 (D283G)
Ref Sequence ENSEMBL: ENSMUSP00000027961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961]
Predicted Effect probably damaging
Transcript: ENSMUST00000027961
AA Change: D283G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865
AA Change: D283G

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Hspa14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hspa14 APN 2 3502759 missense probably damaging 1.00
IGL02293:Hspa14 APN 2 3511034 missense probably damaging 1.00
IGL02477:Hspa14 APN 2 3496624 missense probably damaging 0.98
IGL02711:Hspa14 APN 2 3502520 missense probably benign 0.15
R0522:Hspa14 UTSW 2 3511049 missense probably damaging 1.00
R1169:Hspa14 UTSW 2 3498124 missense possibly damaging 0.90
R1426:Hspa14 UTSW 2 3508821 missense probably damaging 1.00
R1471:Hspa14 UTSW 2 3491608 missense probably benign 0.01
R1846:Hspa14 UTSW 2 3491660 missense possibly damaging 0.50
R1971:Hspa14 UTSW 2 3489767 missense possibly damaging 0.51
R2353:Hspa14 UTSW 2 3511176 splice site probably null
R3508:Hspa14 UTSW 2 3491008 missense probably damaging 1.00
R3859:Hspa14 UTSW 2 3494579 nonsense probably null
R4012:Hspa14 UTSW 2 3512638 missense probably damaging 0.99
R4360:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R4938:Hspa14 UTSW 2 3491609 missense probably benign 0.01
R5028:Hspa14 UTSW 2 3498169 missense possibly damaging 0.72
R5326:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5542:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5881:Hspa14 UTSW 2 3498170 missense probably benign 0.34
R6046:Hspa14 UTSW 2 3489764 missense possibly damaging 0.91
R6076:Hspa14 UTSW 2 3511072 missense probably benign 0.00
R6112:Hspa14 UTSW 2 3498068 missense probably benign
R6334:Hspa14 UTSW 2 3489072 unclassified probably null
R7297:Hspa14 UTSW 2 3498142 missense possibly damaging 0.76
R7424:Hspa14 UTSW 2 3489041 missense possibly damaging 0.95
R7510:Hspa14 UTSW 2 3498122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACTGCAGCAGCTATTGAGTC -3'
(R):5'- GAAGCCATGTTGCTACTTCTTG -3'

Sequencing Primer
(F):5'- GGAAAGCTGTTCACTGGA -3'
(R):5'- CATAATGGTGTTTAGAATTTGGTGAC -3'
Posted On2019-11-12