Incidental Mutation 'R7692:Sardh'
ID 593433
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Name sarcosine dehydrogenase
Synonyms
MMRRC Submission 045756-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27078405-27138344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27087651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 740 (V740A)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
AlphaFold Q99LB7
Predicted Effect probably benign
Transcript: ENSMUST00000102886
AA Change: V740A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: V740A

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,973,832 (GRCm39) T390I probably benign Het
Adgb A G 10: 10,287,456 (GRCm39) probably null Het
Ado G T 10: 67,384,265 (GRCm39) Y113* probably null Het
Angptl1 A G 1: 156,672,885 (GRCm39) E237G probably damaging Het
Arid2 T A 15: 96,254,578 (GRCm39) Y141* probably null Het
Clvs1 T C 4: 9,350,739 (GRCm39) I183T probably benign Het
Dnah1 T C 14: 31,014,295 (GRCm39) K1817E probably benign Het
Eif3e C A 15: 43,126,642 (GRCm39) R271L probably damaging Het
Eml6 A G 11: 29,703,085 (GRCm39) V1611A probably damaging Het
Enpp3 G T 10: 24,660,739 (GRCm39) Y634* probably null Het
Evi5l C T 8: 4,250,886 (GRCm39) R394W probably damaging Het
Fcgr3 A C 1: 170,881,661 (GRCm39) F156V probably damaging Het
Fmo1 T A 1: 162,661,402 (GRCm39) T294S probably benign Het
Gabrb3 A G 7: 57,466,203 (GRCm39) Q339R probably damaging Het
Gen1 T A 12: 11,292,167 (GRCm39) T606S probably benign Het
Gfod1 T C 13: 43,354,528 (GRCm39) Q149R probably benign Het
Golm1 A G 13: 59,788,071 (GRCm39) V276A probably benign Het
Hc C A 2: 34,914,161 (GRCm39) V849F probably damaging Het
Hectd4 T C 5: 121,459,627 (GRCm39) I832T possibly damaging Het
Hspa14 T C 2: 3,497,643 (GRCm39) D283G probably damaging Het
Lztfl1 C T 9: 123,541,536 (GRCm39) W94* probably null Het
Lzts3 T C 2: 130,477,306 (GRCm39) S381G probably benign Het
Mgat2 A G 12: 69,231,444 (GRCm39) Y6C probably damaging Het
Mrpl30 T C 1: 37,934,439 (GRCm39) I27T probably benign Het
Muc5b A T 7: 141,406,966 (GRCm39) T1045S unknown Het
Nlrp4a G A 7: 26,148,690 (GRCm39) R99Q probably benign Het
Or10g1 T C 14: 52,647,945 (GRCm39) Y128C probably damaging Het
Or5b98 A G 19: 12,931,006 (GRCm39) T18A possibly damaging Het
Phlpp1 T C 1: 106,209,132 (GRCm39) L495P probably damaging Het
Pla2g4d T C 2: 120,109,776 (GRCm39) D178G possibly damaging Het
Prl5a1 C G 13: 28,333,997 (GRCm39) L167V probably damaging Het
Sbno1 T G 5: 124,543,709 (GRCm39) T277P probably benign Het
Slc2a1 T C 4: 118,993,462 (GRCm39) V433A probably damaging Het
Slc4a10 T C 2: 62,134,308 (GRCm39) V1008A possibly damaging Het
Smarcal1 T G 1: 72,625,179 (GRCm39) S109A probably benign Het
Speg A G 1: 75,377,834 (GRCm39) D864G probably benign Het
Steap4 T C 5: 8,026,976 (GRCm39) I313T probably benign Het
Tab2 A T 10: 7,786,869 (GRCm39) D614E probably damaging Het
Tenm4 A G 7: 96,544,610 (GRCm39) K2246E probably damaging Het
Timm23 A G 14: 31,902,520 (GRCm39) S208P probably damaging Het
Tmem229a C A 6: 24,955,211 (GRCm39) C181F probably benign Het
Ugdh T C 5: 65,574,958 (GRCm39) Y356C probably damaging Het
Ugt2a1 A G 5: 87,634,586 (GRCm39) L7P probably damaging Het
Uhrf1 A G 17: 56,619,905 (GRCm39) D272G possibly damaging Het
Vmn1r206 T A 13: 22,804,827 (GRCm39) I127F probably damaging Het
Vmn2r106 T C 17: 20,505,490 (GRCm39) Y68C possibly damaging Het
Zfand6 G A 7: 84,283,141 (GRCm39) P72L not run Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27,105,125 (GRCm39) missense probably benign 0.07
IGL01686:Sardh APN 2 27,079,625 (GRCm39) missense probably damaging 1.00
IGL01868:Sardh APN 2 27,117,159 (GRCm39) missense probably benign 0.35
IGL02167:Sardh APN 2 27,081,987 (GRCm39) missense probably damaging 0.98
IGL02272:Sardh APN 2 27,115,003 (GRCm39) missense probably benign 0.00
IGL02870:Sardh APN 2 27,125,503 (GRCm39) missense possibly damaging 0.93
IGL03117:Sardh APN 2 27,129,458 (GRCm39) missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27,118,326 (GRCm39) missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27,087,660 (GRCm39) missense probably damaging 1.00
R0265:Sardh UTSW 2 27,117,078 (GRCm39) splice site probably benign
R0781:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1110:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1242:Sardh UTSW 2 27,125,575 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1514:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R1565:Sardh UTSW 2 27,132,731 (GRCm39) missense probably damaging 1.00
R1832:Sardh UTSW 2 27,125,581 (GRCm39) missense possibly damaging 0.95
R1836:Sardh UTSW 2 27,105,194 (GRCm39) missense possibly damaging 0.65
R1997:Sardh UTSW 2 27,134,409 (GRCm39) missense probably damaging 0.97
R2006:Sardh UTSW 2 27,118,351 (GRCm39) missense probably damaging 1.00
R2046:Sardh UTSW 2 27,105,094 (GRCm39) missense possibly damaging 0.95
R2242:Sardh UTSW 2 27,125,527 (GRCm39) missense possibly damaging 0.93
R2897:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R4332:Sardh UTSW 2 27,105,126 (GRCm39) missense possibly damaging 0.85
R4807:Sardh UTSW 2 27,079,539 (GRCm39) missense probably benign 0.00
R4841:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4842:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4856:Sardh UTSW 2 27,134,489 (GRCm39) missense probably benign 0.02
R4936:Sardh UTSW 2 27,118,253 (GRCm39) splice site probably null
R5089:Sardh UTSW 2 27,129,625 (GRCm39) critical splice donor site probably null
R5110:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R5257:Sardh UTSW 2 27,134,271 (GRCm39) missense probably damaging 0.98
R5406:Sardh UTSW 2 27,101,096 (GRCm39) missense possibly damaging 0.72
R5450:Sardh UTSW 2 27,129,710 (GRCm39) missense possibly damaging 0.65
R5594:Sardh UTSW 2 27,110,735 (GRCm39) missense probably damaging 1.00
R5870:Sardh UTSW 2 27,110,653 (GRCm39) critical splice donor site probably null
R6014:Sardh UTSW 2 27,087,540 (GRCm39) critical splice donor site probably null
R6021:Sardh UTSW 2 27,079,655 (GRCm39) missense probably benign 0.44
R6470:Sardh UTSW 2 27,134,384 (GRCm39) missense probably damaging 1.00
R6577:Sardh UTSW 2 27,108,867 (GRCm39) missense possibly damaging 0.95
R6750:Sardh UTSW 2 27,118,269 (GRCm39) missense probably benign 0.04
R7035:Sardh UTSW 2 27,120,854 (GRCm39) missense probably damaging 1.00
R7162:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R7256:Sardh UTSW 2 27,108,824 (GRCm39) missense probably benign
R7709:Sardh UTSW 2 27,131,529 (GRCm39) missense possibly damaging 0.62
R7884:Sardh UTSW 2 27,129,383 (GRCm39) missense probably damaging 0.99
R8028:Sardh UTSW 2 27,120,467 (GRCm39) missense probably damaging 1.00
R8095:Sardh UTSW 2 27,132,730 (GRCm39) missense probably damaging 1.00
R8120:Sardh UTSW 2 27,108,863 (GRCm39) missense possibly damaging 0.62
R8302:Sardh UTSW 2 27,105,122 (GRCm39) missense probably benign 0.03
R8323:Sardh UTSW 2 27,125,576 (GRCm39) missense probably damaging 1.00
R8535:Sardh UTSW 2 27,129,657 (GRCm39) missense probably damaging 1.00
R8704:Sardh UTSW 2 27,120,477 (GRCm39) missense possibly damaging 0.50
R8781:Sardh UTSW 2 27,086,715 (GRCm39) missense possibly damaging 0.95
R8858:Sardh UTSW 2 27,118,302 (GRCm39) missense probably null 1.00
R9265:Sardh UTSW 2 27,105,065 (GRCm39) missense probably damaging 0.99
R9337:Sardh UTSW 2 27,086,678 (GRCm39) missense probably benign 0.11
R9342:Sardh UTSW 2 27,120,869 (GRCm39) missense possibly damaging 0.95
R9539:Sardh UTSW 2 27,134,298 (GRCm39) missense probably damaging 0.99
R9600:Sardh UTSW 2 27,120,513 (GRCm39) missense probably benign
R9714:Sardh UTSW 2 27,079,641 (GRCm39) missense possibly damaging 0.64
X0011:Sardh UTSW 2 27,132,758 (GRCm39) missense probably damaging 1.00
Z1176:Sardh UTSW 2 27,108,902 (GRCm39) missense possibly damaging 0.52
Z1176:Sardh UTSW 2 27,108,846 (GRCm39) missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27,086,685 (GRCm39) missense probably benign 0.08
Z1177:Sardh UTSW 2 27,125,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAAATTGCACAAGGCTGG -3'
(R):5'- AGCTCAGCTTCTGTGAACACTC -3'

Sequencing Primer
(F):5'- TCTAAACACCAGTGACAGGAGTG -3'
(R):5'- TTCTGTGAACACTCCTCAGAAAGTC -3'
Posted On 2019-11-12