Incidental Mutation 'R7692:Pla2g4d'
ID 593436
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission 045756-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120109776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect possibly damaging
Transcript: ENSMUST00000094665
AA Change: D178G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: D178G

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,973,832 (GRCm39) T390I probably benign Het
Adgb A G 10: 10,287,456 (GRCm39) probably null Het
Ado G T 10: 67,384,265 (GRCm39) Y113* probably null Het
Angptl1 A G 1: 156,672,885 (GRCm39) E237G probably damaging Het
Arid2 T A 15: 96,254,578 (GRCm39) Y141* probably null Het
Clvs1 T C 4: 9,350,739 (GRCm39) I183T probably benign Het
Dnah1 T C 14: 31,014,295 (GRCm39) K1817E probably benign Het
Eif3e C A 15: 43,126,642 (GRCm39) R271L probably damaging Het
Eml6 A G 11: 29,703,085 (GRCm39) V1611A probably damaging Het
Enpp3 G T 10: 24,660,739 (GRCm39) Y634* probably null Het
Evi5l C T 8: 4,250,886 (GRCm39) R394W probably damaging Het
Fcgr3 A C 1: 170,881,661 (GRCm39) F156V probably damaging Het
Fmo1 T A 1: 162,661,402 (GRCm39) T294S probably benign Het
Gabrb3 A G 7: 57,466,203 (GRCm39) Q339R probably damaging Het
Gen1 T A 12: 11,292,167 (GRCm39) T606S probably benign Het
Gfod1 T C 13: 43,354,528 (GRCm39) Q149R probably benign Het
Golm1 A G 13: 59,788,071 (GRCm39) V276A probably benign Het
Hc C A 2: 34,914,161 (GRCm39) V849F probably damaging Het
Hectd4 T C 5: 121,459,627 (GRCm39) I832T possibly damaging Het
Hspa14 T C 2: 3,497,643 (GRCm39) D283G probably damaging Het
Lztfl1 C T 9: 123,541,536 (GRCm39) W94* probably null Het
Lzts3 T C 2: 130,477,306 (GRCm39) S381G probably benign Het
Mgat2 A G 12: 69,231,444 (GRCm39) Y6C probably damaging Het
Mrpl30 T C 1: 37,934,439 (GRCm39) I27T probably benign Het
Muc5b A T 7: 141,406,966 (GRCm39) T1045S unknown Het
Nlrp4a G A 7: 26,148,690 (GRCm39) R99Q probably benign Het
Or10g1 T C 14: 52,647,945 (GRCm39) Y128C probably damaging Het
Or5b98 A G 19: 12,931,006 (GRCm39) T18A possibly damaging Het
Phlpp1 T C 1: 106,209,132 (GRCm39) L495P probably damaging Het
Prl5a1 C G 13: 28,333,997 (GRCm39) L167V probably damaging Het
Sardh A G 2: 27,087,651 (GRCm39) V740A probably benign Het
Sbno1 T G 5: 124,543,709 (GRCm39) T277P probably benign Het
Slc2a1 T C 4: 118,993,462 (GRCm39) V433A probably damaging Het
Slc4a10 T C 2: 62,134,308 (GRCm39) V1008A possibly damaging Het
Smarcal1 T G 1: 72,625,179 (GRCm39) S109A probably benign Het
Speg A G 1: 75,377,834 (GRCm39) D864G probably benign Het
Steap4 T C 5: 8,026,976 (GRCm39) I313T probably benign Het
Tab2 A T 10: 7,786,869 (GRCm39) D614E probably damaging Het
Tenm4 A G 7: 96,544,610 (GRCm39) K2246E probably damaging Het
Timm23 A G 14: 31,902,520 (GRCm39) S208P probably damaging Het
Tmem229a C A 6: 24,955,211 (GRCm39) C181F probably benign Het
Ugdh T C 5: 65,574,958 (GRCm39) Y356C probably damaging Het
Ugt2a1 A G 5: 87,634,586 (GRCm39) L7P probably damaging Het
Uhrf1 A G 17: 56,619,905 (GRCm39) D272G possibly damaging Het
Vmn1r206 T A 13: 22,804,827 (GRCm39) I127F probably damaging Het
Vmn2r106 T C 17: 20,505,490 (GRCm39) Y68C possibly damaging Het
Zfand6 G A 7: 84,283,141 (GRCm39) P72L not run Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120,114,644 (GRCm39) missense probably benign
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120,100,045 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7860:Pla2g4d UTSW 2 120,097,211 (GRCm39) missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8737:Pla2g4d UTSW 2 120,100,466 (GRCm39) missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCTAAAGAGAGCCTTCCC -3'
(R):5'- TGGACTGACTTGGATGTCCC -3'

Sequencing Primer
(F):5'- AAGAGAGCCTTCCCAGATTGCTTG -3'
(R):5'- TTGGATGTCCCACATGAGAC -3'
Posted On 2019-11-12