Mutagenetix > Incidental Mutation

Incidental Mutation 'R7692:Pla2g4d'

593436

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4d

Ensembl Gene

ENSMUSG00000070719

Gene Name

phospholipase A2, group IVD

Synonyms

Pla2delta, 2610311B01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R7692 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120265595-120289197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120279295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 178 (D178G)

Ref Sequence

ENSEMBL: ENSMUSP00000092252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094665]

AlphaFold

Q50L43

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094665
AA Change: D178G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: D178G

Domain	Start	End	E-Value	Type
C2	32	132	1.12e-18	SMART
PLAc	263	766	3.36e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,520,795	T390I	probably benign	Het
Adgb	A	G	10: 10,411,712		probably null	Het
Ado	G	T	10: 67,548,435	Y113*	probably null	Het
Angptl1	A	G	1: 156,845,315	E237G	probably damaging	Het
Arid2	T	A	15: 96,356,697	Y141*	probably null	Het
Clvs1	T	C	4: 9,350,739	I183T	probably benign	Het
Dnah1	T	C	14: 31,292,338	K1817E	probably benign	Het
Eif3e	C	A	15: 43,263,246	R271L	probably damaging	Het
Eml6	A	G	11: 29,753,085	V1611A	probably damaging	Het
Enpp3	G	T	10: 24,784,841	Y634*	probably null	Het
Evi5l	C	T	8: 4,200,886	R394W	probably damaging	Het
Fcgr3	A	C	1: 171,054,092	F156V	probably damaging	Het
Fmo1	T	A	1: 162,833,833	T294S	probably benign	Het
Gabrb3	A	G	7: 57,816,455	Q339R	probably damaging	Het
Gen1	T	A	12: 11,242,166	T606S	probably benign	Het
Gfod1	T	C	13: 43,201,052	Q149R	probably benign	Het
Golm1	A	G	13: 59,640,257	V276A	probably benign	Het
Hc	C	A	2: 35,024,149	V849F	probably damaging	Het
Hectd4	T	C	5: 121,321,564	I832T	possibly damaging	Het
Hspa14	T	C	2: 3,496,606	D283G	probably damaging	Het
Lztfl1	C	T	9: 123,712,471	W94*	probably null	Het
Lzts3	T	C	2: 130,635,386	S381G	probably benign	Het
Mgat2	A	G	12: 69,184,670	Y6C	probably damaging	Het
Mrpl30	T	C	1: 37,895,358	I27T	probably benign	Het
Muc5b	A	T	7: 141,853,229	T1045S	unknown	Het
Nlrp4a	G	A	7: 26,449,265	R99Q	probably benign	Het
Olfr1450	A	G	19: 12,953,642	T18A	possibly damaging	Het
Olfr1510	T	C	14: 52,410,488	Y128C	probably damaging	Het
Phlpp1	T	C	1: 106,281,402	L495P	probably damaging	Het
Prl5a1	C	G	13: 28,150,014	L167V	probably damaging	Het
Sardh	A	G	2: 27,197,639	V740A	probably benign	Het
Sbno1	T	G	5: 124,405,646	T277P	probably benign	Het
Slc2a1	T	C	4: 119,136,265	V433A	probably damaging	Het
Slc4a10	T	C	2: 62,303,964	V1008A	possibly damaging	Het
Smarcal1	T	G	1: 72,586,020	S109A	probably benign	Het
Speg	A	G	1: 75,401,190	D864G	probably benign	Het
Steap4	T	C	5: 7,976,976	I313T	probably benign	Het
Tab2	A	T	10: 7,911,105	D614E	probably damaging	Het
Tenm4	A	G	7: 96,895,403	K2246E	probably damaging	Het
Timm23	A	G	14: 32,180,563	S208P	probably damaging	Het
Tmem229a	C	A	6: 24,955,212	C181F	probably benign	Het
Ugdh	T	C	5: 65,417,615	Y356C	probably damaging	Het
Ugt2a1	A	G	5: 87,486,727	L7P	probably damaging	Het
Uhrf1	A	G	17: 56,312,905	D272G	possibly damaging	Het
Vmn1r206	T	A	13: 22,620,657	I127F	probably damaging	Het
Vmn2r106	T	C	17: 20,285,228	Y68C	possibly damaging	Het
Zfand6	G	A	7: 84,633,933	P72L	not run	Het

Other mutations in Pla2g4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pla2g4d	APN	2	120281726	missense	probably damaging	1.00
IGL01405:Pla2g4d	APN	2	120266823	missense	probably benign	0.01
IGL01642:Pla2g4d	APN	2	120280636	missense	probably damaging	1.00
IGL01657:Pla2g4d	APN	2	120275287	missense	possibly damaging	0.91
BB001:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R0962:Pla2g4d	UTSW	2	120280617	critical splice donor site	probably null
R1564:Pla2g4d	UTSW	2	120268903	missense	possibly damaging	0.76
R1576:Pla2g4d	UTSW	2	120284167	missense	probably damaging	1.00
R1667:Pla2g4d	UTSW	2	120270150	splice site	probably benign
R1680:Pla2g4d	UTSW	2	120277750	critical splice donor site	probably null
R1712:Pla2g4d	UTSW	2	120277490	missense	possibly damaging	0.51
R2253:Pla2g4d	UTSW	2	120271141	missense	probably damaging	0.99
R2919:Pla2g4d	UTSW	2	120281627	splice site	probably benign
R3122:Pla2g4d	UTSW	2	120278903	missense	probably benign	0.03
R4420:Pla2g4d	UTSW	2	120284163	missense	probably benign
R4737:Pla2g4d	UTSW	2	120266790	missense	probably benign	0.00
R4829:Pla2g4d	UTSW	2	120266743	missense	probably damaging	1.00
R5032:Pla2g4d	UTSW	2	120281695	nonsense	probably null
R5530:Pla2g4d	UTSW	2	120269555	missense	probably benign	0.06
R5677:Pla2g4d	UTSW	2	120278948	missense	possibly damaging	0.87
R6087:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6088:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6150:Pla2g4d	UTSW	2	120269564	missense	probably damaging	1.00
R6930:Pla2g4d	UTSW	2	120270633	missense	probably damaging	1.00
R7240:Pla2g4d	UTSW	2	120270349	missense	probably damaging	1.00
R7284:Pla2g4d	UTSW	2	120284136	missense	probably damaging	1.00
R7339:Pla2g4d	UTSW	2	120278978	missense	probably benign
R7552:Pla2g4d	UTSW	2	120284139	missense	possibly damaging	0.56
R7607:Pla2g4d	UTSW	2	120288976	missense	probably benign
R7860:Pla2g4d	UTSW	2	120266730	missense	probably benign	0.13
R7924:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R7972:Pla2g4d	UTSW	2	120278932	missense	probably benign	0.04
R8373:Pla2g4d	UTSW	2	120277499	missense	probably null	1.00
R8737:Pla2g4d	UTSW	2	120269985	missense	probably damaging	1.00
R8752:Pla2g4d	UTSW	2	120268767	critical splice donor site	probably null
R8987:Pla2g4d	UTSW	2	120269961	missense	probably damaging	1.00
R9221:Pla2g4d	UTSW	2	120269972	missense	possibly damaging	0.76
R9251:Pla2g4d	UTSW	2	120268897	missense	possibly damaging	0.87
R9740:Pla2g4d	UTSW	2	120277471	missense	probably damaging	1.00
X0026:Pla2g4d	UTSW	2	120277471	missense	probably damaging	0.99
X0028:Pla2g4d	UTSW	2	120281726	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCTAAAGAGAGCCTTCCC -3'
(R):5'- TGGACTGACTTGGATGTCCC -3'

Sequencing Primer
(F):5'- AAGAGAGCCTTCCCAGATTGCTTG -3'
(R):5'- TTGGATGTCCCACATGAGAC -3'

Posted On

2019-11-12