Incidental Mutation 'R7692:Lzts3'
ID593437
Institutional Source Beutler Lab
Gene Symbol Lzts3
Ensembl Gene ENSMUSG00000037703
Gene Nameleucine zipper, putative tumor suppressor family member 3
SynonymsProsapip1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130632839-130642803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130635386 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 381 (S381G)
Ref Sequence ENSEMBL: ENSMUSP00000105889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045761] [ENSMUST00000089561] [ENSMUST00000110260]
Predicted Effect probably benign
Transcript: ENSMUST00000045761
AA Change: S495G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000037109
Gene: ENSMUSG00000037703
AA Change: S495G

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 665 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089561
AA Change: S495G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000086990
Gene: ENSMUSG00000037703
AA Change: S495G

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 666 2.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110260
AA Change: S381G

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105889
Gene: ENSMUSG00000037703
AA Change: S381G

DomainStartEndE-ValueType
low complexity region 126 136 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 187 219 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
low complexity region 288 322 N/A INTRINSIC
Pfam:Fez1 351 552 1.5e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Lzts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Lzts3 APN 2 130635445 missense probably damaging 0.99
IGL01541:Lzts3 APN 2 130636206 missense probably damaging 0.99
IGL01649:Lzts3 APN 2 130635431 missense probably damaging 0.98
IGL02746:Lzts3 APN 2 130636341 missense probably damaging 0.98
IGL02927:Lzts3 APN 2 130637957 utr 5 prime probably benign
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0173:Lzts3 UTSW 2 130634768 makesense probably null
R1381:Lzts3 UTSW 2 130635299 missense probably damaging 0.99
R4127:Lzts3 UTSW 2 130635365 missense probably damaging 0.99
R4301:Lzts3 UTSW 2 130636438 missense probably damaging 0.99
R4588:Lzts3 UTSW 2 130634766 makesense probably null
R5289:Lzts3 UTSW 2 130636101 missense probably benign 0.18
R5878:Lzts3 UTSW 2 130636539 missense probably damaging 1.00
R5964:Lzts3 UTSW 2 130636288 missense probably damaging 0.99
R6193:Lzts3 UTSW 2 130637386 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGGAGCTGTTTCTGATACTC -3'
(R):5'- CCCTATGAGTGCTTAGTGCC -3'

Sequencing Primer
(F):5'- GGAGCTGTTTCTGATACTCAATGACC -3'
(R):5'- CCTTTGGAGATAGATCTGGGAGC -3'
Posted On2019-11-12