Incidental Mutation 'R7692:Slc2a1'
ID593439
Institutional Source Beutler Lab
Gene Symbol Slc2a1
Ensembl Gene ENSMUSG00000028645
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 1
SynonymsGlut1, Glut-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location119108711-119137983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119136265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 433 (V433A)
Ref Sequence ENSEMBL: ENSMUSP00000030398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030398] [ENSMUST00000134105] [ENSMUST00000144329] [ENSMUST00000174372] [ENSMUST00000208090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030398
AA Change: V433A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030398
Gene: ENSMUSG00000028645
AA Change: V433A

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 467 1e-164 PFAM
Pfam:MFS_1 24 418 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134105
SMART Domains Protein: ENSMUSP00000118641
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 12 128 7.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144329
SMART Domains Protein: ENSMUSP00000134126
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 4 123 1.5e-35 PFAM
Pfam:MFS_1 5 123 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174372
SMART Domains Protein: ENSMUSP00000134714
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 173 9.3e-53 PFAM
Pfam:MFS_1 18 172 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208090
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null embryos are small, lack visibly detectable eyes, show a diminutive rostral embryonic pole and an overall developmental delay, and die at E10-E14. Heterozygotes show spontaneous seizures, impaired motor performance, hypoglycorrhachia, microencephaly, and reduced brain glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Slc2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Slc2a1 APN 4 119132238 missense possibly damaging 0.94
IGL01876:Slc2a1 APN 4 119133378 missense probably benign 0.11
IGL02355:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
IGL02362:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
R1076:Slc2a1 UTSW 4 119134448 missense probably damaging 0.98
R1561:Slc2a1 UTSW 4 119136409 missense possibly damaging 0.86
R1616:Slc2a1 UTSW 4 119136306 missense probably damaging 1.00
R3015:Slc2a1 UTSW 4 119132143 missense probably damaging 1.00
R4166:Slc2a1 UTSW 4 119133116 missense probably damaging 0.97
R4795:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R4796:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R6025:Slc2a1 UTSW 4 119136342 missense possibly damaging 0.68
R7403:Slc2a1 UTSW 4 119132555 missense probably damaging 1.00
R7429:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7430:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7524:Slc2a1 UTSW 4 119132612 missense probably damaging 1.00
R7768:Slc2a1 UTSW 4 119132447 missense probably damaging 1.00
R7845:Slc2a1 UTSW 4 119135928 missense possibly damaging 0.91
R8236:Slc2a1 UTSW 4 119133257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCTGGAGCCTGTCACAG -3'
(R):5'- TGTGCTCCAGAGAGATCCTTGG -3'

Sequencing Primer
(F):5'- GTCACAGGACAGGTTTTCATAGCAC -3'
(R):5'- AGAGATCCTTGGGCTGCAG -3'
Posted On2019-11-12