Incidental Mutation 'R7692:Ugt2a1'
ID 593442
Institutional Source Beutler Lab
Gene Symbol Ugt2a1
Ensembl Gene ENSMUSG00000106677
Gene Name UDP glucuronosyltransferase 2 family, polypeptide A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 87459490-87490871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87486727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 7 (L7P)
Ref Sequence ENSEMBL: ENSMUSP00000114583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079811] [ENSMUST00000144144] [ENSMUST00000147854] [ENSMUST00000201519]
AlphaFold Q80X89
Predicted Effect probably benign
Transcript: ENSMUST00000079811
SMART Domains Protein: ENSMUSP00000078740
Gene: ENSMUSG00000029268

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:UDPGT 22 525 3.5e-233 PFAM
Pfam:Glyco_tran_28_C 332 453 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144144
SMART Domains Protein: ENSMUSP00000114842
Gene: ENSMUSG00000029268

DomainStartEndE-ValueType
Pfam:UDPGT 1 277 2.3e-168 PFAM
Pfam:Glyco_tran_28_C 100 203 7.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147854
AA Change: L7P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114583
Gene: ENSMUSG00000106677
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDPGT 21 525 1.2e-235 PFAM
Pfam:Glyco_tran_28_C 332 453 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201519
AA Change: L7P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143986
Gene: ENSMUSG00000107180
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDPGT 21 240 2.3e-54 PFAM
Pfam:UDPGT 236 499 2.9e-75 PFAM
Pfam:UDPGT 498 691 2.6e-116 PFAM
Pfam:Glyco_tran_28_C 512 618 3.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family, members of which catalyze biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This enzyme is expressed in the olfactory neuroepithelium, which lines the posterior nasal cavity and is exposed to a wide range of odorants and airborne toxic compounds. Hence, this protein has been suggested to be involved in clearing lipophilic odorant molecules from the sensory epithelium. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. This gene shares exon structure with the UDP glucuronosyltransferase 2A2 family member, which encodes N-terminally distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Ugt2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Ugt2a1 UTSW 5 87474861 nonsense probably null
R4654:Ugt2a1 UTSW 5 87486224 missense probably damaging 1.00
R4834:Ugt2a1 UTSW 5 87486035 splice site probably null
R5145:Ugt2a1 UTSW 5 87486027 critical splice donor site probably null
R5540:Ugt2a1 UTSW 5 87486056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAATGTCAGAGATGGGCTGATG -3'
(R):5'- ATAGCTTACTTTGAGCCTGATTCC -3'

Sequencing Primer
(F):5'- TCAGAGATGGGCTGATGGATGATG -3'
(R):5'- TGAGCCTGATTCCATTAAACATG -3'
Posted On 2019-11-12