Incidental Mutation 'R7692:Hectd4'
ID 593443
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 045756-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.925) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121358282-121506640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121459627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 832 (I832T)
Ref Sequence ENSEMBL: ENSMUSP00000098332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: I2169T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: I2169T

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100769
AA Change: I832T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: I832T

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,973,832 (GRCm39) T390I probably benign Het
Adgb A G 10: 10,287,456 (GRCm39) probably null Het
Ado G T 10: 67,384,265 (GRCm39) Y113* probably null Het
Angptl1 A G 1: 156,672,885 (GRCm39) E237G probably damaging Het
Arid2 T A 15: 96,254,578 (GRCm39) Y141* probably null Het
Clvs1 T C 4: 9,350,739 (GRCm39) I183T probably benign Het
Dnah1 T C 14: 31,014,295 (GRCm39) K1817E probably benign Het
Eif3e C A 15: 43,126,642 (GRCm39) R271L probably damaging Het
Eml6 A G 11: 29,703,085 (GRCm39) V1611A probably damaging Het
Enpp3 G T 10: 24,660,739 (GRCm39) Y634* probably null Het
Evi5l C T 8: 4,250,886 (GRCm39) R394W probably damaging Het
Fcgr3 A C 1: 170,881,661 (GRCm39) F156V probably damaging Het
Fmo1 T A 1: 162,661,402 (GRCm39) T294S probably benign Het
Gabrb3 A G 7: 57,466,203 (GRCm39) Q339R probably damaging Het
Gen1 T A 12: 11,292,167 (GRCm39) T606S probably benign Het
Gfod1 T C 13: 43,354,528 (GRCm39) Q149R probably benign Het
Golm1 A G 13: 59,788,071 (GRCm39) V276A probably benign Het
Hc C A 2: 34,914,161 (GRCm39) V849F probably damaging Het
Hspa14 T C 2: 3,497,643 (GRCm39) D283G probably damaging Het
Lztfl1 C T 9: 123,541,536 (GRCm39) W94* probably null Het
Lzts3 T C 2: 130,477,306 (GRCm39) S381G probably benign Het
Mgat2 A G 12: 69,231,444 (GRCm39) Y6C probably damaging Het
Mrpl30 T C 1: 37,934,439 (GRCm39) I27T probably benign Het
Muc5b A T 7: 141,406,966 (GRCm39) T1045S unknown Het
Nlrp4a G A 7: 26,148,690 (GRCm39) R99Q probably benign Het
Or10g1 T C 14: 52,647,945 (GRCm39) Y128C probably damaging Het
Or5b98 A G 19: 12,931,006 (GRCm39) T18A possibly damaging Het
Phlpp1 T C 1: 106,209,132 (GRCm39) L495P probably damaging Het
Pla2g4d T C 2: 120,109,776 (GRCm39) D178G possibly damaging Het
Prl5a1 C G 13: 28,333,997 (GRCm39) L167V probably damaging Het
Sardh A G 2: 27,087,651 (GRCm39) V740A probably benign Het
Sbno1 T G 5: 124,543,709 (GRCm39) T277P probably benign Het
Slc2a1 T C 4: 118,993,462 (GRCm39) V433A probably damaging Het
Slc4a10 T C 2: 62,134,308 (GRCm39) V1008A possibly damaging Het
Smarcal1 T G 1: 72,625,179 (GRCm39) S109A probably benign Het
Speg A G 1: 75,377,834 (GRCm39) D864G probably benign Het
Steap4 T C 5: 8,026,976 (GRCm39) I313T probably benign Het
Tab2 A T 10: 7,786,869 (GRCm39) D614E probably damaging Het
Tenm4 A G 7: 96,544,610 (GRCm39) K2246E probably damaging Het
Timm23 A G 14: 31,902,520 (GRCm39) S208P probably damaging Het
Tmem229a C A 6: 24,955,211 (GRCm39) C181F probably benign Het
Ugdh T C 5: 65,574,958 (GRCm39) Y356C probably damaging Het
Ugt2a1 A G 5: 87,634,586 (GRCm39) L7P probably damaging Het
Uhrf1 A G 17: 56,619,905 (GRCm39) D272G possibly damaging Het
Vmn1r206 T A 13: 22,804,827 (GRCm39) I127F probably damaging Het
Vmn2r106 T C 17: 20,505,490 (GRCm39) Y68C possibly damaging Het
Zfand6 G A 7: 84,283,141 (GRCm39) P72L not run Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,501,933 (GRCm39) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,487,169 (GRCm39) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,469,764 (GRCm39) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,445,013 (GRCm39) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,477,480 (GRCm39) splice site probably benign
IGL01474:Hectd4 APN 5 121,474,712 (GRCm39) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,456,714 (GRCm39) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,502,723 (GRCm39) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,460,763 (GRCm39) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,482,887 (GRCm39) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,466,481 (GRCm39) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,504,669 (GRCm39) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,430,150 (GRCm39) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,456,676 (GRCm39) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,482,848 (GRCm39) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,491,944 (GRCm39) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,487,465 (GRCm39) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,480,782 (GRCm39) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,445,067 (GRCm39) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,486,857 (GRCm39) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,397,942 (GRCm39) missense probably benign
IGL03181:Hectd4 APN 5 121,492,021 (GRCm39) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,398,002 (GRCm39) splice site probably benign
IGL03375:Hectd4 APN 5 121,466,445 (GRCm39) missense possibly damaging 0.72
Achilles UTSW 5 121,445,444 (GRCm39) nonsense probably null
agamemnon UTSW 5 121,391,921 (GRCm39) splice site probably benign
clymnestra UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
hector UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
helen UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
Merriwether UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,471,123 (GRCm39) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,392,242 (GRCm39) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,446,639 (GRCm39) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,400,651 (GRCm39) nonsense probably null
R0080:Hectd4 UTSW 5 121,487,435 (GRCm39) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0128:Hectd4 UTSW 5 121,487,306 (GRCm39) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,467,668 (GRCm39) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,392,314 (GRCm39) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,397,927 (GRCm39) missense probably benign
R0410:Hectd4 UTSW 5 121,424,329 (GRCm39) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,481,145 (GRCm39) splice site probably null
R0442:Hectd4 UTSW 5 121,462,045 (GRCm39) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,502,653 (GRCm39) splice site probably null
R0469:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0510:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,469,770 (GRCm39) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,486,539 (GRCm39) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,442,400 (GRCm39) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,481,295 (GRCm39) splice site probably benign
R0622:Hectd4 UTSW 5 121,486,688 (GRCm39) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,415,887 (GRCm39) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,424,526 (GRCm39) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,474,691 (GRCm39) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,445,096 (GRCm39) unclassified probably benign
R0764:Hectd4 UTSW 5 121,424,832 (GRCm39) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,424,799 (GRCm39) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,448,662 (GRCm39) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,488,548 (GRCm39) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,459,570 (GRCm39) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,456,687 (GRCm39) nonsense probably null
R1391:Hectd4 UTSW 5 121,491,758 (GRCm39) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,466,576 (GRCm39) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,462,019 (GRCm39) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,487,322 (GRCm39) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,439,941 (GRCm39) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,455,308 (GRCm39) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,436,167 (GRCm39) missense probably benign
R1715:Hectd4 UTSW 5 121,482,881 (GRCm39) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,487,593 (GRCm39) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,496,366 (GRCm39) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,429,254 (GRCm39) splice site probably benign
R1784:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,435,243 (GRCm39) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,419,981 (GRCm39) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,493,692 (GRCm39) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,471,487 (GRCm39) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,456,702 (GRCm39) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,391,921 (GRCm39) splice site probably benign
R2192:Hectd4 UTSW 5 121,453,206 (GRCm39) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,491,600 (GRCm39) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,458,089 (GRCm39) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,402,030 (GRCm39) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,358,683 (GRCm39) missense unknown
R2904:Hectd4 UTSW 5 121,430,787 (GRCm39) splice site probably benign
R3843:Hectd4 UTSW 5 121,397,936 (GRCm39) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,458,164 (GRCm39) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,441,588 (GRCm39) splice site probably benign
R4133:Hectd4 UTSW 5 121,415,897 (GRCm39) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,358,567 (GRCm39) small deletion probably benign
R4413:Hectd4 UTSW 5 121,488,544 (GRCm39) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,424,320 (GRCm39) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,452,970 (GRCm39) nonsense probably null
R4564:Hectd4 UTSW 5 121,488,494 (GRCm39) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,424,482 (GRCm39) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,435,266 (GRCm39) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,487,279 (GRCm39) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,487,118 (GRCm39) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,463,314 (GRCm39) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,441,678 (GRCm39) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,480,040 (GRCm39) missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121,486,505 (GRCm39) missense probably benign
R4781:Hectd4 UTSW 5 121,444,170 (GRCm39) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,460,735 (GRCm39) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,401,954 (GRCm39) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,497,378 (GRCm39) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,460,753 (GRCm39) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,467,628 (GRCm39) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,466,262 (GRCm39) splice site probably null
R5129:Hectd4 UTSW 5 121,481,573 (GRCm39) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,482,887 (GRCm39) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,481,739 (GRCm39) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,402,037 (GRCm39) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,442,511 (GRCm39) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,453,464 (GRCm39) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,448,666 (GRCm39) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,404,337 (GRCm39) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,445,011 (GRCm39) missense probably benign
R5507:Hectd4 UTSW 5 121,419,164 (GRCm39) missense unknown
R5552:Hectd4 UTSW 5 121,480,914 (GRCm39) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,486,878 (GRCm39) missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121,491,565 (GRCm39) missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121,486,682 (GRCm39) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,445,587 (GRCm39) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,481,288 (GRCm39) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,462,037 (GRCm39) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,446,941 (GRCm39) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,477,561 (GRCm39) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,392,283 (GRCm39) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,488,508 (GRCm39) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,488,655 (GRCm39) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,494,259 (GRCm39) splice site probably null
R6540:Hectd4 UTSW 5 121,441,634 (GRCm39) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,458,147 (GRCm39) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,445,444 (GRCm39) nonsense probably null
R6736:Hectd4 UTSW 5 121,415,788 (GRCm39) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,491,574 (GRCm39) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,502,631 (GRCm39) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,437,660 (GRCm39) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,411,692 (GRCm39) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,446,405 (GRCm39) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,467,136 (GRCm39) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,452,944 (GRCm39) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,419,995 (GRCm39) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,462,024 (GRCm39) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,496,196 (GRCm39) splice site probably null
R7482:Hectd4 UTSW 5 121,501,941 (GRCm39) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,435,172 (GRCm39) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,481,728 (GRCm39) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,453,573 (GRCm39) splice site probably null
R7560:Hectd4 UTSW 5 121,392,405 (GRCm39) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,429,288 (GRCm39) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,487,522 (GRCm39) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,456,798 (GRCm39) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,392,434 (GRCm39) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,462,094 (GRCm39) missense probably benign 0.06
R7725:Hectd4 UTSW 5 121,358,680 (GRCm39) missense unknown
R7731:Hectd4 UTSW 5 121,445,077 (GRCm39) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,474,692 (GRCm39) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,443,784 (GRCm39) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,467,631 (GRCm39) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,469,880 (GRCm39) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,392,291 (GRCm39) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,448,692 (GRCm39) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,477,581 (GRCm39) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,459,461 (GRCm39) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,471,012 (GRCm39) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,424,439 (GRCm39) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,456,819 (GRCm39) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,477,607 (GRCm39) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,404,424 (GRCm39) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,455,288 (GRCm39) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8397:Hectd4 UTSW 5 121,397,957 (GRCm39) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,446,421 (GRCm39) missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121,481,210 (GRCm39) missense probably benign 0.00
R8443:Hectd4 UTSW 5 121,467,172 (GRCm39) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8516:Hectd4 UTSW 5 121,487,073 (GRCm39) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,442,489 (GRCm39) nonsense probably null
R8553:Hectd4 UTSW 5 121,491,661 (GRCm39) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,448,714 (GRCm39) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,488,557 (GRCm39) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,501,838 (GRCm39) nonsense probably null
R8769:Hectd4 UTSW 5 121,419,936 (GRCm39) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,461,994 (GRCm39) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,433,541 (GRCm39) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,466,305 (GRCm39) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,415,819 (GRCm39) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,496,347 (GRCm39) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,441,629 (GRCm39) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,392,422 (GRCm39) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,451,955 (GRCm39) missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121,411,677 (GRCm39) missense probably benign 0.14
R9106:Hectd4 UTSW 5 121,467,619 (GRCm39) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,496,238 (GRCm39) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,487,097 (GRCm39) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,391,967 (GRCm39) missense
R9162:Hectd4 UTSW 5 121,445,042 (GRCm39) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,446,690 (GRCm39) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,437,551 (GRCm39) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,433,496 (GRCm39) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,487,028 (GRCm39) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,486,952 (GRCm39) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,437,708 (GRCm39) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,472,492 (GRCm39) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,460,864 (GRCm39) missense probably benign 0.01
R9491:Hectd4 UTSW 5 121,452,981 (GRCm39) missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121,502,616 (GRCm39) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,459,617 (GRCm39) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,472,532 (GRCm39) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,424,844 (GRCm39) nonsense probably null
R9704:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9712:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,392,254 (GRCm39) nonsense probably null
R9750:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,472,415 (GRCm39) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,487,700 (GRCm39) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,459,467 (GRCm39) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,433,566 (GRCm39) splice site probably null
Z1177:Hectd4 UTSW 5 121,496,383 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGTTCTGTCTCGAGCATTG -3'
(R):5'- CCCATAGGTAACATTAGACAGCACTG -3'

Sequencing Primer
(F):5'- CGAGCATTGATGTACATTCCAC -3'
(R):5'- GCCTTAGCATTCGAGCAATG -3'
Posted On 2019-11-12