Incidental Mutation 'R7692:Tmem229a'
ID 593445
Institutional Source Beutler Lab
Gene Symbol Tmem229a
Ensembl Gene ENSMUSG00000048022
Gene Name transmembrane protein 229A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 24951141-24956297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24955212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 181 (C181F)
Ref Sequence ENSEMBL: ENSMUSP00000116234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127247]
AlphaFold B9EJI9
Predicted Effect probably benign
Transcript: ENSMUST00000127247
AA Change: C181F

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116234
Gene: ENSMUSG00000048022
AA Change: C181F

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
internal_repeat_1 51 108 1.6e-5 PROSPERO
low complexity region 139 163 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
internal_repeat_1 229 286 1.6e-5 PROSPERO
transmembrane domain 301 319 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Tmem229a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02239:Tmem229a APN 6 24955540 missense probably damaging 1.00
IGL02801:Tmem229a APN 6 24955122 missense probably benign 0.09
R0077:Tmem229a UTSW 6 24955702 missense probably benign
R1932:Tmem229a UTSW 6 24955011 missense probably damaging 1.00
R2016:Tmem229a UTSW 6 24955062 missense probably benign 0.00
R3522:Tmem229a UTSW 6 24955059 missense probably benign 0.01
R4229:Tmem229a UTSW 6 24954832 missense probably damaging 1.00
R4230:Tmem229a UTSW 6 24954832 missense probably damaging 1.00
R5610:Tmem229a UTSW 6 24955581 missense probably damaging 1.00
R5836:Tmem229a UTSW 6 24955017 missense probably damaging 1.00
R5869:Tmem229a UTSW 6 24954687 missense probably damaging 1.00
R5878:Tmem229a UTSW 6 24955173 missense probably benign
R6505:Tmem229a UTSW 6 24954921 missense probably damaging 1.00
R6915:Tmem229a UTSW 6 24954658 missense probably benign 0.19
R7442:Tmem229a UTSW 6 24955690 missense probably damaging 1.00
R8252:Tmem229a UTSW 6 24955581 missense probably damaging 1.00
R8844:Tmem229a UTSW 6 24955188 missense probably benign 0.00
R8881:Tmem229a UTSW 6 24955588 missense probably damaging 1.00
Z1176:Tmem229a UTSW 6 24954881 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAAAGCCATGCATTCCG -3'
(R):5'- GGATGCTGGGTTTCTCTTCACC -3'

Sequencing Primer
(F):5'- GCCATGCATTCCGAAGAAAAG -3'
(R):5'- CCTGGAGCAGCTCTACCTG -3'
Posted On 2019-11-12