Incidental Mutation 'R7692:Nlrp4a'
ID 593446
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 045756-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26148690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 99 (R99Q)
Ref Sequence ENSEMBL: ENSMUSP00000066841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: R99Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: R99Q

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: R99Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: R99Q

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: R99Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,973,832 (GRCm39) T390I probably benign Het
Adgb A G 10: 10,287,456 (GRCm39) probably null Het
Ado G T 10: 67,384,265 (GRCm39) Y113* probably null Het
Angptl1 A G 1: 156,672,885 (GRCm39) E237G probably damaging Het
Arid2 T A 15: 96,254,578 (GRCm39) Y141* probably null Het
Clvs1 T C 4: 9,350,739 (GRCm39) I183T probably benign Het
Dnah1 T C 14: 31,014,295 (GRCm39) K1817E probably benign Het
Eif3e C A 15: 43,126,642 (GRCm39) R271L probably damaging Het
Eml6 A G 11: 29,703,085 (GRCm39) V1611A probably damaging Het
Enpp3 G T 10: 24,660,739 (GRCm39) Y634* probably null Het
Evi5l C T 8: 4,250,886 (GRCm39) R394W probably damaging Het
Fcgr3 A C 1: 170,881,661 (GRCm39) F156V probably damaging Het
Fmo1 T A 1: 162,661,402 (GRCm39) T294S probably benign Het
Gabrb3 A G 7: 57,466,203 (GRCm39) Q339R probably damaging Het
Gen1 T A 12: 11,292,167 (GRCm39) T606S probably benign Het
Gfod1 T C 13: 43,354,528 (GRCm39) Q149R probably benign Het
Golm1 A G 13: 59,788,071 (GRCm39) V276A probably benign Het
Hc C A 2: 34,914,161 (GRCm39) V849F probably damaging Het
Hectd4 T C 5: 121,459,627 (GRCm39) I832T possibly damaging Het
Hspa14 T C 2: 3,497,643 (GRCm39) D283G probably damaging Het
Lztfl1 C T 9: 123,541,536 (GRCm39) W94* probably null Het
Lzts3 T C 2: 130,477,306 (GRCm39) S381G probably benign Het
Mgat2 A G 12: 69,231,444 (GRCm39) Y6C probably damaging Het
Mrpl30 T C 1: 37,934,439 (GRCm39) I27T probably benign Het
Muc5b A T 7: 141,406,966 (GRCm39) T1045S unknown Het
Or10g1 T C 14: 52,647,945 (GRCm39) Y128C probably damaging Het
Or5b98 A G 19: 12,931,006 (GRCm39) T18A possibly damaging Het
Phlpp1 T C 1: 106,209,132 (GRCm39) L495P probably damaging Het
Pla2g4d T C 2: 120,109,776 (GRCm39) D178G possibly damaging Het
Prl5a1 C G 13: 28,333,997 (GRCm39) L167V probably damaging Het
Sardh A G 2: 27,087,651 (GRCm39) V740A probably benign Het
Sbno1 T G 5: 124,543,709 (GRCm39) T277P probably benign Het
Slc2a1 T C 4: 118,993,462 (GRCm39) V433A probably damaging Het
Slc4a10 T C 2: 62,134,308 (GRCm39) V1008A possibly damaging Het
Smarcal1 T G 1: 72,625,179 (GRCm39) S109A probably benign Het
Speg A G 1: 75,377,834 (GRCm39) D864G probably benign Het
Steap4 T C 5: 8,026,976 (GRCm39) I313T probably benign Het
Tab2 A T 10: 7,786,869 (GRCm39) D614E probably damaging Het
Tenm4 A G 7: 96,544,610 (GRCm39) K2246E probably damaging Het
Timm23 A G 14: 31,902,520 (GRCm39) S208P probably damaging Het
Tmem229a C A 6: 24,955,211 (GRCm39) C181F probably benign Het
Ugdh T C 5: 65,574,958 (GRCm39) Y356C probably damaging Het
Ugt2a1 A G 5: 87,634,586 (GRCm39) L7P probably damaging Het
Uhrf1 A G 17: 56,619,905 (GRCm39) D272G possibly damaging Het
Vmn1r206 T A 13: 22,804,827 (GRCm39) I127F probably damaging Het
Vmn2r106 T C 17: 20,505,490 (GRCm39) Y68C possibly damaging Het
Zfand6 G A 7: 84,283,141 (GRCm39) P72L not run Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATTGTTCTGGGCCAACAG -3'
(R):5'- AGTGTCTTGCCAACTCCAGC -3'

Sequencing Primer
(F):5'- GCTACTCATGGACAGTGGTAAATCC -3'
(R):5'- TTGCCAACTCCAGCACCAC -3'
Posted On 2019-11-12