Incidental Mutation 'R7692:Gabrb3'
ID593447
Institutional Source Beutler Lab
Gene Symbol Gabrb3
Ensembl Gene ENSMUSG00000033676
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 3
SynonymsA230092K12Rik, Gabrb-3, beta3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location57419692-57828802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57816455 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 339 (Q339R)
Ref Sequence ENSEMBL: ENSMUSP00000143353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039697] [ENSMUST00000085240] [ENSMUST00000138350] [ENSMUST00000196198]
Predicted Effect probably benign
Transcript: ENSMUST00000039697
AA Change: Q339R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038051
Gene: ENSMUSG00000033676
AA Change: Q339R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 1.3e-53 PFAM
Pfam:Neur_chan_memb 250 468 2.4e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085240
AA Change: Q361R

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082337
Gene: ENSMUSG00000033676
AA Change: Q361R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 5.1e-51 PFAM
Pfam:Neur_chan_memb 250 468 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138350
SMART Domains Protein: ENSMUSP00000118835
Gene: ENSMUSG00000033676

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 123 2.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196198
AA Change: Q339R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143353
Gene: ENSMUSG00000033676
AA Change: Q339R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 9.7e-54 PFAM
Pfam:Neur_chan_memb 250 468 2e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mutants die at birth with cleft palate. Survivors show delayed growth, reduced lifespan, seizures, ataxia, hyperactivity, hyperresponsiveness and reduced learning, mothering ability and REM sleep. A point mutation lowers anesthetic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Gabrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Gabrb3 APN 7 57816478 missense probably benign 0.00
IGL01878:Gabrb3 APN 7 57816415 missense probably damaging 1.00
IGL02092:Gabrb3 APN 7 57765586 missense probably damaging 1.00
IGL02193:Gabrb3 APN 7 57792516 missense probably damaging 1.00
IGL02676:Gabrb3 APN 7 57591364 intron probably benign
R0325:Gabrb3 UTSW 7 57765530 missense probably damaging 1.00
R1560:Gabrb3 UTSW 7 57816295 missense probably damaging 0.98
R1562:Gabrb3 UTSW 7 57765514 nonsense probably null
R1714:Gabrb3 UTSW 7 57765428 missense probably damaging 1.00
R2054:Gabrb3 UTSW 7 57824493 missense probably benign 0.04
R4134:Gabrb3 UTSW 7 57591288 missense probably benign 0.01
R4135:Gabrb3 UTSW 7 57591288 missense probably benign 0.01
R4176:Gabrb3 UTSW 7 57591313 missense probably benign 0.00
R4761:Gabrb3 UTSW 7 57765502 missense probably damaging 1.00
R4869:Gabrb3 UTSW 7 57792459 intron probably benign
R5247:Gabrb3 UTSW 7 57590591 missense possibly damaging 0.96
R6935:Gabrb3 UTSW 7 57591813 missense probably damaging 0.99
R7479:Gabrb3 UTSW 7 57824423 missense possibly damaging 0.74
R7562:Gabrb3 UTSW 7 57812178 nonsense probably null
R8530:Gabrb3 UTSW 7 57812071 missense probably damaging 1.00
R8819:Gabrb3 UTSW 7 57792581 missense probably damaging 1.00
R8820:Gabrb3 UTSW 7 57792581 missense probably damaging 1.00
X0064:Gabrb3 UTSW 7 57812185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACTGTGATCTGAGCTG -3'
(R):5'- GATAAGGAACCTGGAGTTTTGCC -3'

Sequencing Primer
(F):5'- GATCTGAGCTGCGGTACTCATAC -3'
(R):5'- AACCTGGAGTTTTGCCCTAGGAAC -3'
Posted On2019-11-12