Incidental Mutation 'R7692:Lztfl1'
ID593453
Institutional Source Beutler Lab
Gene Symbol Lztfl1
Ensembl Gene ENSMUSG00000025245
Gene Nameleucine zipper transcription factor-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123694416-123717697 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 123712471 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 94 (W94*)
Ref Sequence ENSEMBL: ENSMUSP00000026274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026274] [ENSMUST00000163207] [ENSMUST00000163559] [ENSMUST00000166097]
Predicted Effect probably null
Transcript: ENSMUST00000026274
AA Change: W94*
SMART Domains Protein: ENSMUSP00000026274
Gene: ENSMUSG00000025245
AA Change: W94*

DomainStartEndE-ValueType
Pfam:Leu_zip 20 294 1e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098258
AA Change: W51*
SMART Domains Protein: ENSMUSP00000095858
Gene: ENSMUSG00000025245
AA Change: W51*

DomainStartEndE-ValueType
Pfam:Leu_zip 1 218 1.1e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163207
AA Change: W101*
Predicted Effect probably benign
Transcript: ENSMUST00000163559
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165754
AA Change: W84*
Predicted Effect probably null
Transcript: ENSMUST00000166097
AA Change: W94*
SMART Domains Protein: ENSMUSP00000130872
Gene: ENSMUSG00000025245
AA Change: W94*

DomainStartEndE-ValueType
Pfam:Leu_zip 20 134 8.5e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168921
AA Change: W51*
SMART Domains Protein: ENSMUSP00000132359
Gene: ENSMUSG00000025245
AA Change: W51*

DomainStartEndE-ValueType
Pfam:Leu_zip 1 117 4.3e-60 PFAM
Pfam:Leu_zip 109 230 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed protein that localizes to the cytoplasm. This protein interacts with Bardet-Biedl Syndrome (BBS) proteins and, through its interaction with BBS protein complexes, regulates protein trafficking to the ciliary membrane. Nonsense mutations in this gene cause a form of Bardet-Biedl Syndrome; a ciliopathy characterized in part by polydactyly, obesity, cognitive impairment, hypogonadism, and kidney failure. This gene may also function as a tumor suppressor; possibly by interacting with E-cadherin and the actin cytoskeleton and thereby regulating the transition of epithelial cells to mesenchymal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit obesity, ventriculomegaly, decreased ERG a- and b-wave amplitudes, abnormal photoreceptor outer segment (OS) structure with large vesicle formation, and progressive retinal photoreceptor degeneration due to accumulation of non-OS proteins in the OS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Lztfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Lztfl1 APN 9 123702273 missense probably benign 0.34
IGL01610:Lztfl1 APN 9 123700091 missense probably benign 0.00
IGL03084:Lztfl1 APN 9 123709576 missense probably damaging 1.00
R0382:Lztfl1 UTSW 9 123707906 splice site probably null
R2010:Lztfl1 UTSW 9 123702186 missense possibly damaging 0.61
R4832:Lztfl1 UTSW 9 123715389 missense possibly damaging 0.80
R6894:Lztfl1 UTSW 9 123700933 missense possibly damaging 0.94
R6974:Lztfl1 UTSW 9 123709584 missense probably benign 0.31
R7703:Lztfl1 UTSW 9 123702129 missense probably damaging 1.00
R7719:Lztfl1 UTSW 9 123715330 missense probably null 0.54
R8244:Lztfl1 UTSW 9 123712449 missense probably damaging 0.97
R8536:Lztfl1 UTSW 9 123711054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGGCCTTTGAGTGCTCC -3'
(R):5'- GTTGCTCCTGTGACTAACGAG -3'

Sequencing Primer
(F):5'- CTCCTCAAGGAAGGAATCATCTAGTG -3'
(R):5'- CTAACGAGCCAATGGTGTCATACTG -3'
Posted On2019-11-12