Incidental Mutation 'R7692:Tab2'
ID593454
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7905653-7956230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7911105 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 614 (D614E)
Ref Sequence ENSEMBL: ENSMUSP00000121266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146444] [ENSMUST00000147938]
PDB Structure Crystal structure of the mouse TAB2-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000146444
AA Change: D614E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: D614E

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147938
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7910073 missense probably benign 0.21
IGL01316:Tab2 APN 10 7924704 missense probably damaging 1.00
IGL01902:Tab2 APN 10 7919992 missense probably benign 0.12
IGL03338:Tab2 APN 10 7919275 missense probably damaging 1.00
Cosmo UTSW 10 7924719 missense probably damaging 1.00
Cosmo-2 UTSW 10 7907481 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0271:Tab2 UTSW 10 7919158 missense probably benign
R0458:Tab2 UTSW 10 7919555 missense probably damaging 1.00
R0608:Tab2 UTSW 10 7920119 missense probably damaging 0.99
R0632:Tab2 UTSW 10 7919801 missense probably benign 0.07
R0744:Tab2 UTSW 10 7907581 unclassified probably benign
R1162:Tab2 UTSW 10 7924719 missense probably damaging 1.00
R1424:Tab2 UTSW 10 7920048 missense possibly damaging 0.86
R1954:Tab2 UTSW 10 7919330 missense probably damaging 1.00
R2516:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2518:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2520:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R3418:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R4081:Tab2 UTSW 10 7919831 missense probably damaging 1.00
R4177:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R4178:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R5410:Tab2 UTSW 10 7919821 missense possibly damaging 0.86
R5681:Tab2 UTSW 10 7920073 missense probably damaging 1.00
R5683:Tab2 UTSW 10 7919112 critical splice donor site probably null
R6857:Tab2 UTSW 10 7920413 missense possibly damaging 0.50
R7424:Tab2 UTSW 10 7907483 missense probably damaging 1.00
R7790:Tab2 UTSW 10 7920424 missense probably damaging 1.00
R7792:Tab2 UTSW 10 7919133 missense possibly damaging 0.50
R8897:Tab2 UTSW 10 7911133 missense probably damaging 1.00
Z1088:Tab2 UTSW 10 7920266 missense possibly damaging 0.88
Z1177:Tab2 UTSW 10 7919179 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACCAGGTACATATTTACTGAGGGC -3'
(R):5'- CTGCCACAGTGTAAAGGCTTG -3'

Sequencing Primer
(F):5'- GCAAAGAAGCCAACTGTTCTTTAGC -3'
(R):5'- CCACAGTGTAAAGGCTTGCTCTAG -3'
Posted On2019-11-12