Incidental Mutation 'R7692:Enpp3'
ID 593456
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 045756-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24772406-24842823 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 24784841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 634 (Y634*)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect probably null
Transcript: ENSMUST00000020169
AA Change: Y634*
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: Y634*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218343
AA Change: Y211*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 (GRCm38) T390I probably benign Het
Adgb A G 10: 10,411,712 (GRCm38) probably null Het
Ado G T 10: 67,548,435 (GRCm38) Y113* probably null Het
Angptl1 A G 1: 156,845,315 (GRCm38) E237G probably damaging Het
Arid2 T A 15: 96,356,697 (GRCm38) Y141* probably null Het
Clvs1 T C 4: 9,350,739 (GRCm38) I183T probably benign Het
Dnah1 T C 14: 31,292,338 (GRCm38) K1817E probably benign Het
Eif3e C A 15: 43,263,246 (GRCm38) R271L probably damaging Het
Eml6 A G 11: 29,753,085 (GRCm38) V1611A probably damaging Het
Evi5l C T 8: 4,200,886 (GRCm38) R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 (GRCm38) F156V probably damaging Het
Fmo1 T A 1: 162,833,833 (GRCm38) T294S probably benign Het
Gabrb3 A G 7: 57,816,455 (GRCm38) Q339R probably damaging Het
Gen1 T A 12: 11,242,166 (GRCm38) T606S probably benign Het
Gfod1 T C 13: 43,201,052 (GRCm38) Q149R probably benign Het
Golm1 A G 13: 59,640,257 (GRCm38) V276A probably benign Het
Hc C A 2: 35,024,149 (GRCm38) V849F probably damaging Het
Hectd4 T C 5: 121,321,564 (GRCm38) I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 (GRCm38) D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 (GRCm38) W94* probably null Het
Lzts3 T C 2: 130,635,386 (GRCm38) S381G probably benign Het
Mgat2 A G 12: 69,184,670 (GRCm38) Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 (GRCm38) I27T probably benign Het
Muc5b A T 7: 141,853,229 (GRCm38) T1045S unknown Het
Nlrp4a G A 7: 26,449,265 (GRCm38) R99Q probably benign Het
Or10g1 T C 14: 52,410,488 (GRCm38) Y128C probably damaging Het
Or5b98 A G 19: 12,953,642 (GRCm38) T18A possibly damaging Het
Phlpp1 T C 1: 106,281,402 (GRCm38) L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 (GRCm38) D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 (GRCm38) L167V probably damaging Het
Sardh A G 2: 27,197,639 (GRCm38) V740A probably benign Het
Sbno1 T G 5: 124,405,646 (GRCm38) T277P probably benign Het
Slc2a1 T C 4: 119,136,265 (GRCm38) V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 (GRCm38) V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 (GRCm38) S109A probably benign Het
Speg A G 1: 75,401,190 (GRCm38) D864G probably benign Het
Steap4 T C 5: 7,976,976 (GRCm38) I313T probably benign Het
Tab2 A T 10: 7,911,105 (GRCm38) D614E probably damaging Het
Tenm4 A G 7: 96,895,403 (GRCm38) K2246E probably damaging Het
Timm23 A G 14: 32,180,563 (GRCm38) S208P probably damaging Het
Tmem229a C A 6: 24,955,212 (GRCm38) C181F probably benign Het
Ugdh T C 5: 65,417,615 (GRCm38) Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 (GRCm38) L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 (GRCm38) D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 (GRCm38) I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 (GRCm38) Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 (GRCm38) P72L not run Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,787,772 (GRCm38) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,798,262 (GRCm38) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,774,907 (GRCm38) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,805,922 (GRCm38) nonsense probably null
IGL01642:Enpp3 APN 10 24,798,269 (GRCm38) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,792,025 (GRCm38) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,776,794 (GRCm38) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,774,002 (GRCm38) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,791,983 (GRCm38) splice site probably benign
IGL02517:Enpp3 APN 10 24,809,848 (GRCm38) splice site probably benign
IGL02956:Enpp3 APN 10 24,774,943 (GRCm38) splice site probably benign
R0017:Enpp3 UTSW 10 24,799,153 (GRCm38) splice site probably null
R0042:Enpp3 UTSW 10 24,774,824 (GRCm38) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,776,781 (GRCm38) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,776,869 (GRCm38) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,804,436 (GRCm38) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,820,597 (GRCm38) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,776,781 (GRCm38) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,776,781 (GRCm38) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,795,716 (GRCm38) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,784,953 (GRCm38) splice site probably benign
R1261:Enpp3 UTSW 10 24,774,934 (GRCm38) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,795,782 (GRCm38) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,778,789 (GRCm38) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,776,771 (GRCm38) nonsense probably null
R1966:Enpp3 UTSW 10 24,807,491 (GRCm38) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,776,878 (GRCm38) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,805,895 (GRCm38) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,776,872 (GRCm38) missense probably benign
R2410:Enpp3 UTSW 10 24,774,818 (GRCm38) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,831,732 (GRCm38) splice site probably null
R3896:Enpp3 UTSW 10 24,777,949 (GRCm38) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,793,589 (GRCm38) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,776,882 (GRCm38) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,773,927 (GRCm38) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,798,277 (GRCm38) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,807,538 (GRCm38) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,776,767 (GRCm38) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,809,916 (GRCm38) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,808,160 (GRCm38) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,778,821 (GRCm38) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,774,842 (GRCm38) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,787,852 (GRCm38) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,808,191 (GRCm38) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,777,957 (GRCm38) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,807,453 (GRCm38) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,809,870 (GRCm38) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,808,166 (GRCm38) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,826,195 (GRCm38) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,774,047 (GRCm38) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,776,884 (GRCm38) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,817,844 (GRCm38) missense unknown
R7487:Enpp3 UTSW 10 24,805,923 (GRCm38) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,798,174 (GRCm38) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,836,092 (GRCm38) start codon destroyed probably null 0.83
R7962:Enpp3 UTSW 10 24,784,854 (GRCm38) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,778,819 (GRCm38) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,809,879 (GRCm38) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,777,926 (GRCm38) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,824,929 (GRCm38) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,826,241 (GRCm38) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,774,835 (GRCm38) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,774,835 (GRCm38) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,820,615 (GRCm38) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,798,274 (GRCm38) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,795,804 (GRCm38) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,826,180 (GRCm38) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,799,194 (GRCm38) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,774,818 (GRCm38) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,778,791 (GRCm38) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,836,092 (GRCm38) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,809,903 (GRCm38) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,773,904 (GRCm38) makesense probably null
X0026:Enpp3 UTSW 10 24,826,242 (GRCm38) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,787,793 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTGGCAGAAGTCCACCC -3'
(R):5'- AGATCTTTGCTTAGCACCTGGG -3'

Sequencing Primer
(F):5'- AGAAGTCCACCCTCACTTTGG -3'
(R):5'- ATGCCTGATACATGCTCAGACAGTG -3'
Posted On 2019-11-12