Incidental Mutation 'R7692:Mgat2'
ID593460
Institutional Source Beutler Lab
Gene Symbol Mgat2
Ensembl Gene ENSMUSG00000043998
Gene Namemannoside acetylglucosaminyltransferase 2
SynonymsCDGS2, GNT-II, GNT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69184157-69186770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69184670 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 6 (Y6C)
Ref Sequence ENSEMBL: ENSMUSP00000057905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000054544] [ENSMUST00000060579] [ENSMUST00000110619] [ENSMUST00000110620]
Predicted Effect probably benign
Transcript: ENSMUST00000021356
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054544
SMART Domains Protein: ENSMUSP00000059766
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 94 6.3e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060579
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057905
Gene: ENSMUSG00000043998
AA Change: Y6C

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:MGAT2 87 435 2.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110619
SMART Domains Protein: ENSMUSP00000106249
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110620
SMART Domains Protein: ENSMUSP00000106250
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a Golgi enzyme catalyzing an essential step in the conversion of oligomannose to complex N-glycans. The enzyme has the typical glycosyltransferase domains: a short N-terminal cytoplasmic domain, a hydrophobic non-cleavable signal-anchor domain, and a C-terminal catalytic domain. Mutations in this gene may lead to carbohydrate-deficient glycoprotein syndrome, type II. The coding region of this gene is intronless. Transcript variants with a spliced 5' UTR may exist, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice recapitulate aspects of the phenotype exhibited by patients with congenital disorders of glycosylation (CDG), particularly type IIa. Most null mice died either embyronically or postnataly and exhibited muscular, gastrointestinal, hematologic, and osteogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Mgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Mgat2 APN 12 69185641 missense probably damaging 0.99
IGL02428:Mgat2 APN 12 69184784 missense probably benign 0.45
IGL03064:Mgat2 APN 12 69185003 missense probably damaging 1.00
R0554:Mgat2 UTSW 12 69185392 missense probably benign
R1698:Mgat2 UTSW 12 69185719 missense probably benign
R1759:Mgat2 UTSW 12 69185527 missense probably benign 0.11
R2130:Mgat2 UTSW 12 69185294 missense probably damaging 1.00
R5982:Mgat2 UTSW 12 69185680 missense probably damaging 1.00
R5986:Mgat2 UTSW 12 69185384 missense probably benign 0.10
R6265:Mgat2 UTSW 12 69184793 missense probably benign
R6699:Mgat2 UTSW 12 69184781 missense probably damaging 0.99
R6841:Mgat2 UTSW 12 69185633 missense probably damaging 0.99
R8005:Mgat2 UTSW 12 69185948 missense probably damaging 1.00
X0026:Mgat2 UTSW 12 69185107 missense probably damaging 1.00
X0060:Mgat2 UTSW 12 69185326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACTGCCAGAGAGGATG -3'
(R):5'- TCAGCATCTGATCGAAGTTCAACTG -3'

Sequencing Primer
(F):5'- GCAGTTGAGAGCCTTCGG -3'
(R):5'- TCTGATCGAAGTTCAACTGGTACACC -3'
Posted On2019-11-12