Incidental Mutation 'R7692:Golm1'
ID593464
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Namegolgi membrane protein 1
Synonyms2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location59634626-59675811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59640257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 276 (V276A)
Ref Sequence ENSEMBL: ENSMUSP00000022039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000022039] [ENSMUST00000095739]
Predicted Effect probably benign
Transcript: ENSMUST00000022038
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022039
AA Change: V276A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: V276A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095739
AA Change: V276A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: V276A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59649656 missense probably damaging 0.99
IGL01327:Golm1 APN 13 59645144 missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59638377 missense probably benign 0.00
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0458:Golm1 UTSW 13 59664364 missense probably damaging 0.98
R0989:Golm1 UTSW 13 59640183 missense probably benign 0.01
R1301:Golm1 UTSW 13 59638373 missense probably damaging 0.99
R1804:Golm1 UTSW 13 59642389 critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59642251 missense probably benign 0.04
R1940:Golm1 UTSW 13 59642237 splice site probably benign
R2086:Golm1 UTSW 13 59645185 nonsense probably null
R2513:Golm1 UTSW 13 59642258 missense probably benign 0.01
R2887:Golm1 UTSW 13 59640230 missense probably benign 0.00
R3903:Golm1 UTSW 13 59638340 missense probably damaging 1.00
R4154:Golm1 UTSW 13 59642353 missense probably benign 0.01
R5580:Golm1 UTSW 13 59642365 missense probably benign 0.03
R6193:Golm1 UTSW 13 59645158 missense probably benign 0.00
R6418:Golm1 UTSW 13 59665561 missense probably damaging 1.00
R6594:Golm1 UTSW 13 59664227 missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59638383 missense probably damaging 1.00
R6967:Golm1 UTSW 13 59649576 small deletion probably benign
R6968:Golm1 UTSW 13 59649576 small deletion probably benign
R6991:Golm1 UTSW 13 59649576 small deletion probably benign
R6992:Golm1 UTSW 13 59649576 small deletion probably benign
R6993:Golm1 UTSW 13 59649576 small deletion probably benign
R6996:Golm1 UTSW 13 59642244 missense probably benign 0.00
R7576:Golm1 UTSW 13 59645106 missense probably benign 0.00
R7863:Golm1 UTSW 13 59649569 missense probably damaging 1.00
R7948:Golm1 UTSW 13 59664197 critical splice donor site probably null
X0026:Golm1 UTSW 13 59638313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGAAGACCTGCTGACAAG -3'
(R):5'- TTTTGTTTTAGTTAAAATGGTCCTGC -3'

Sequencing Primer
(F):5'- GCAGGAGCTTAGGGACCCAG -3'
(R):5'- GTCTGGTGTACAAAGCAAGTTCC -3'
Posted On2019-11-12