Incidental Mutation 'R7692:Timm23'
ID 593466
Institutional Source Beutler Lab
Gene Symbol Timm23
Ensembl Gene ENSMUSG00000013701
Gene Name translocase of inner mitochondrial membrane 23
Synonyms Tim23
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7692 (G1)
Quality Score 192.009
Status Not validated
Chromosome 14
Chromosomal Location 32180162-32201898 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32180563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 208 (S208P)
Ref Sequence ENSEMBL: ENSMUSP00000013845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000163379] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000170331] [ENSMUST00000226683]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000013845
AA Change: S208P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701
AA Change: S208P

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111994
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163336
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168334
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169722
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226683
AA Change: S196P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex located in the inner mitochondrial membrane that mediates the transport of transit peptide-containing proteins across the membrane. Multiple transcript variants, one protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die prior to E3.5. Mice heterogygous for this allele exhibit background sensitive premature aging and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Timm23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Timm23 APN 14 32180655 missense probably benign 0.34
IGL02023:Timm23 APN 14 32193847 splice site probably benign
R0666:Timm23 UTSW 14 32199036 splice site probably benign
R2214:Timm23 UTSW 14 32198987 missense probably damaging 0.98
R5132:Timm23 UTSW 14 32193945 missense probably damaging 1.00
R5161:Timm23 UTSW 14 32193925 missense probably damaging 1.00
R5427:Timm23 UTSW 14 32189146 missense possibly damaging 0.95
R6518:Timm23 UTSW 14 32201637 splice site probably null
R7659:Timm23 UTSW 14 32198978 nonsense probably null
R9484:Timm23 UTSW 14 32180629 missense probably benign 0.00
R9609:Timm23 UTSW 14 32180586 missense probably benign 0.21
RF024:Timm23 UTSW 14 32180555 makesense probably null
Predicted Primers PCR Primer
(F):5'- CATACTCAGTGAGCCACCAAGG -3'
(R):5'- AGAGCAGCTTTCTCTAAGATACC -3'

Sequencing Primer
(F):5'- TTCCACTCACTGAGGGCAAG -3'
(R):5'- ATATTTTACAGCACTTTTATCCCCG -3'
Posted On 2019-11-12