Incidental Mutation 'R7692:Olfr1510'
ID593467
Institutional Source Beutler Lab
Gene Symbol Olfr1510
Ensembl Gene ENSMUSG00000063106
Gene Nameolfactory receptor 1510
SynonymsGA_x6K02T2RJGY-583652-584608, MOR223-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52409131-52414373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52410488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 128 (Y128C)
Ref Sequence ENSEMBL: ENSMUSP00000150294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079459] [ENSMUST00000215928]
Predicted Effect probably damaging
Transcript: ENSMUST00000079459
AA Change: Y128C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078424
Gene: ENSMUSG00000063106
AA Change: Y128C

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 8.1e-50 PFAM
Pfam:7tm_1 45 293 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215928
AA Change: Y128C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Olfr1510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Olfr1510 APN 14 52410842 missense probably benign 0.04
IGL02097:Olfr1510 APN 14 52410054 missense probably benign
R0282:Olfr1510 UTSW 14 52410263 missense possibly damaging 0.94
R1449:Olfr1510 UTSW 14 52410567 missense probably damaging 1.00
R2113:Olfr1510 UTSW 14 52410296 missense probably damaging 1.00
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2873:Olfr1510 UTSW 14 52410861 missense probably benign
R3409:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R3411:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R4480:Olfr1510 UTSW 14 52410308 missense probably damaging 1.00
R5292:Olfr1510 UTSW 14 52410445 missense possibly damaging 0.90
R5297:Olfr1510 UTSW 14 52410218 missense probably damaging 1.00
R5441:Olfr1510 UTSW 14 52409957 missense probably benign 0.02
R5749:Olfr1510 UTSW 14 52410504 missense probably damaging 1.00
R5872:Olfr1510 UTSW 14 52410768 missense probably damaging 1.00
R5941:Olfr1510 UTSW 14 52410068 missense probably benign 0.01
R7209:Olfr1510 UTSW 14 52410093 missense possibly damaging 0.80
R7379:Olfr1510 UTSW 14 52410261 missense probably benign 0.08
R7463:Olfr1510 UTSW 14 52410711 missense probably benign 0.00
R8894:Olfr1510 UTSW 14 52410008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCAGTTCATTGACAGTCG -3'
(R):5'- TCTCCTTCCTGGACATGTGG -3'

Sequencing Primer
(F):5'- ATTGACAGTCGTATCGGCAC -3'
(R):5'- TGGACATGTGGCTCTCCTCAG -3'
Posted On2019-11-12