Incidental Mutation 'R7692:Eif3e'
ID593468
Institutional Source Beutler Lab
Gene Symbol Eif3e
Ensembl Gene ENSMUSG00000022336
Gene Nameeukaryotic translation initiation factor 3, subunit E
SynonymsEif3s6, eIF3-p46, 48kDa, Int6, eIF3-p48
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location43250058-43282719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43263246 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 271 (R271L)
Ref Sequence ENSEMBL: ENSMUSP00000022960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022960]
Predicted Effect probably damaging
Transcript: ENSMUST00000022960
AA Change: R271L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022960
Gene: ENSMUSG00000022336
AA Change: R271L

DomainStartEndE-ValueType
eIF3_N 5 138 4.88e-70 SMART
Blast:eIF3_N 157 193 2e-14 BLAST
Blast:PINT 218 251 7e-9 BLAST
Blast:PINT 284 315 3e-13 BLAST
PINT 327 411 8.17e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Eif3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Eif3e APN 15 43278349 missense probably benign 0.17
IGL02333:Eif3e APN 15 43266137 missense probably benign 0.37
IGL02669:Eif3e APN 15 43282692 start codon destroyed probably benign
IGL03119:Eif3e APN 15 43265604 missense probably benign
IGL03200:Eif3e APN 15 43252261 missense probably damaging 1.00
Verdugo UTSW 15 43272289 missense probably benign 0.29
R0152:Eif3e UTSW 15 43252236 missense possibly damaging 0.83
R1439:Eif3e UTSW 15 43278428 splice site probably benign
R1613:Eif3e UTSW 15 43250224 missense possibly damaging 0.81
R1997:Eif3e UTSW 15 43265609 missense probably damaging 1.00
R2221:Eif3e UTSW 15 43251547 missense possibly damaging 0.95
R3761:Eif3e UTSW 15 43261084 missense probably damaging 0.99
R4241:Eif3e UTSW 15 43262690 missense probably damaging 0.97
R4571:Eif3e UTSW 15 43266162 missense possibly damaging 0.74
R5061:Eif3e UTSW 15 43252261 missense probably damaging 1.00
R5227:Eif3e UTSW 15 43251521 missense probably benign 0.01
R5367:Eif3e UTSW 15 43252304 missense probably damaging 1.00
R5417:Eif3e UTSW 15 43265521 missense probably benign 0.00
R5497:Eif3e UTSW 15 43270970 missense probably damaging 0.98
R5928:Eif3e UTSW 15 43275332 splice site probably null
R6083:Eif3e UTSW 15 43266144 missense probably damaging 1.00
R6337:Eif3e UTSW 15 43252296 missense possibly damaging 0.95
R6964:Eif3e UTSW 15 43272289 missense probably benign 0.29
R7825:Eif3e UTSW 15 43266271 splice site probably null
R8034:Eif3e UTSW 15 43272307 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTCAGGGCTTGCTAATTTC -3'
(R):5'- GTCATCGGATTCTGCTGATTTTAC -3'

Sequencing Primer
(F):5'- AGGGCTTGCTAATTTCTCTCTAG -3'
(R):5'- GCTTACACTCTTAGGCTAAACGATG -3'
Posted On2019-11-12