Incidental Mutation 'R0240:Tep1'
ID59347
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission 038478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0240 (G1)
Quality Score100
Status Validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 50863029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,768,402 probably benign Het
Acsf3 T C 8: 122,780,181 L71P probably damaging Het
Adamts2 A T 11: 50,775,374 D399V probably damaging Het
Adck2 T A 6: 39,583,818 V380E probably benign Het
Alg11 T A 8: 22,065,452 V243D possibly damaging Het
Ankrd27 T A 7: 35,619,439 L585Q probably damaging Het
Atp7a T A X: 106,109,841 N1117K probably damaging Het
Cacna1b G A 2: 24,638,657 probably benign Het
Cacna1d T A 14: 30,096,969 M1210L probably benign Het
Cacna1s T C 1: 136,073,496 probably benign Het
Ccdc155 C T 7: 45,200,251 A83T probably benign Het
Chd7 T C 4: 8,852,670 probably benign Het
Col12a1 A T 9: 79,652,033 S1858T probably benign Het
Cotl1 C T 8: 119,840,324 W26* probably null Het
Csmd3 T C 15: 47,629,239 T3000A probably benign Het
Dcp1a T A 14: 30,484,594 probably benign Het
Ddhd2 A T 8: 25,739,590 probably null Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Dnm3 G T 1: 162,353,625 Q162K probably benign Het
Dpy19l2 G T 9: 24,658,580 A359D probably damaging Het
Ece1 T A 4: 137,949,435 probably benign Het
Eif4g3 A G 4: 138,170,562 K1025R probably damaging Het
Eml2 C A 7: 19,184,872 Y82* probably null Het
Eml6 A G 11: 29,792,367 V1057A possibly damaging Het
Eral1 A G 11: 78,076,058 probably benign Het
Espl1 T C 15: 102,312,541 S911P probably benign Het
Fbxo8 A G 8: 56,590,261 probably benign Het
Flrt1 A T 19: 7,097,110 probably benign Het
Fndc7 A G 3: 108,858,919 probably benign Het
G3bp1 G A 11: 55,492,028 G139D probably damaging Het
Gabra6 C T 11: 42,314,947 V351I probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Ganab A G 19: 8,912,813 D702G possibly damaging Het
Gm13762 A T 2: 88,973,396 L165Q probably damaging Het
Hdac10 T C 15: 89,125,882 E291G possibly damaging Het
Hectd3 T G 4: 117,002,613 V749G probably damaging Het
Kcnh1 T A 1: 192,505,340 I703N probably benign Het
Kcnma1 G A 14: 23,494,579 T505I probably damaging Het
Kctd11 A G 11: 69,879,814 C133R probably damaging Het
Lama3 A T 18: 12,539,823 probably null Het
Lamb3 T C 1: 193,335,027 L842P probably damaging Het
Ldlr T C 9: 21,737,999 probably benign Het
Lipk G A 19: 34,046,810 R336H probably benign Het
Lrrc24 T A 15: 76,723,209 D58V probably damaging Het
Lrsam1 A G 2: 32,955,185 L106P probably damaging Het
Milr1 G A 11: 106,754,896 W88* probably null Het
Mmp10 A G 9: 7,506,543 D340G probably damaging Het
Mybpc1 T A 10: 88,555,738 Y285F possibly damaging Het
Ncoa3 A G 2: 166,054,400 T408A probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nfasc A G 1: 132,601,983 S814P probably damaging Het
Nlrp4a T C 7: 26,462,516 V863A probably benign Het
Nos1 C T 5: 117,867,883 P223S probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1440 A T 19: 12,394,963 E233D probably benign Het
Olfr155 T A 4: 43,854,512 S68T probably damaging Het
Olfr228 A G 2: 86,483,386 S119P possibly damaging Het
Osbpl5 T C 7: 143,741,669 probably null Het
Otog C A 7: 46,264,032 probably null Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Pbx1 G A 1: 168,203,482 T189I possibly damaging Het
Pcnx T C 12: 81,947,018 I908T possibly damaging Het
Pdxdc1 A T 16: 13,879,445 W124R probably damaging Het
Phex C A X: 157,186,218 D587Y probably damaging Het
Plcb3 A T 19: 6,962,995 D435E probably benign Het
Plce1 A C 19: 38,728,886 K1373T probably damaging Het
Prkcd G A 14: 30,602,088 A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 S421T probably benign Het
Ptprs T C 17: 56,436,087 probably null Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Rcc1 C A 4: 132,332,915 G393V probably damaging Het
Reln T C 5: 22,106,045 N290S probably benign Het
Rgl1 T C 1: 152,554,424 probably benign Het
Rhpn1 C T 15: 75,714,122 T628I probably benign Het
Rilp A G 11: 75,510,921 R176G probably benign Het
Riok3 C T 18: 12,155,227 A487V probably benign Het
Rnf224 T C 2: 25,236,207 T45A probably damaging Het
Rpa1 A G 11: 75,328,687 V137A probably benign Het
Rps6ka1 C A 4: 133,848,531 Q693H probably benign Het
Scn2a G T 2: 65,735,774 V1381F probably benign Het
Scp2 T A 4: 108,098,078 H112L probably benign Het
Sdk1 T C 5: 141,998,747 W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 V408F probably damaging Het
Slc28a2 T A 2: 122,454,527 I332N probably benign Het
Slc37a3 A G 6: 39,337,238 V480A probably benign Het
Slc45a4 T A 15: 73,581,906 E674D probably benign Het
Smpd3 T C 8: 106,265,156 E255G probably damaging Het
Snx29 C T 16: 11,660,553 R658W probably damaging Het
Sppl2a A T 2: 126,920,336 M275K probably benign Het
Stac T C 9: 111,635,021 N59S probably damaging Het
Stk25 A T 1: 93,627,060 L131Q probably damaging Het
Thbs1 C A 2: 118,114,393 N229K probably damaging Het
Tmx2 A T 2: 84,675,842 H89Q probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tradd T C 8: 105,259,292 N209S possibly damaging Het
Trappc3l A T 10: 34,098,932 R119* probably null Het
Trmt1l G A 1: 151,457,454 probably benign Het
Ublcp1 G T 11: 44,458,277 Y243* probably null Het
Uhrf1bp1 T A 17: 27,895,870 probably benign Het
Usp24 C A 4: 106,414,404 C2158* probably null Het
Usp34 A T 11: 23,433,206 K2088N probably damaging Het
Vmn1r53 G C 6: 90,223,943 S133C probably damaging Het
Vmn2r52 A G 7: 10,159,400 V604A probably damaging Het
Vmn2r93 A G 17: 18,304,799 K240E probably benign Het
Wdr13 T G X: 8,128,045 D242A probably damaging Het
Wwp1 C T 4: 19,641,734 probably null Het
Zan G A 5: 137,398,362 H4311Y unknown Het
Zc3h12c C A 9: 52,144,083 R123L possibly damaging Het
Zfp125 A T 12: 20,900,561 noncoding transcript Het
Zfp318 C T 17: 46,396,813 P266S probably benign Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 intron probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 intron probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCAAACAGGAAGTGCGTTCACAGAG -3'
(R):5'- TCCTGCATCCAAATGCCCAGAGAG -3'

Sequencing Primer
(F):5'- GCTACACAGGTTATCTGGGC -3'
(R):5'- cttcctccccctaccctc -3'
Posted On2013-07-11