Incidental Mutation 'R7692:Uhrf1'
ID 593471
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Name ubiquitin-like, containing PHD and RING finger domains, 1
Synonyms ICBP90, Np95
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 56303321-56323486 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56312905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 272 (D272G)
Ref Sequence ENSEMBL: ENSMUSP00000001258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]
AlphaFold Q8VDF2
PDB Structure Crystal structure of the SRA domain of mouse Np95 in complex with hemi-methylated CpG DNA [X-RAY DIFFRACTION]
Crystal structure of the SRA domain of mouse Np95 in complex with hemi-methylated CpG DNA [X-RAY DIFFRACTION]
Crystal structure of the SRA domain of mouse Np95 in complex with hemi-methylated CpG DNA [X-RAY DIFFRACTION]
Crystal structure of unliganded SRA domain of mouse Np95 [X-RAY DIFFRACTION]
mouse NP95 SRA domain DNA specific complex 1 [X-RAY DIFFRACTION]
Mouse NP95 SRA domain DNA specific complex 2 [X-RAY DIFFRACTION]
Mouse NP95 SRA domain non-specific DNA complex [X-RAY DIFFRACTION]
Mouse UHRF1 SRA domain bound with hemi-methylated CpG, crystal structure in space group P21 [X-RAY DIFFRACTION]
Mouse UHRF1 SRA domain bound with hemi-methylated CpG, crystal structure in space group C222(1) [X-RAY DIFFRACTION]
Mouse UHRF1 SRA domain bound with hemi-methylated CpG DNA, crystal structure in space group C222(1) at 1.4 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001258
AA Change: D272G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228
AA Change: D272G

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113035
AA Change: D272G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228
AA Change: D272G

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113038
AA Change: D272G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228
AA Change: D272G

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113039
AA Change: D272G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228
AA Change: D272G

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142387
SMART Domains Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56318125 missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56320535 missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56318250 missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56305129 missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56310677 missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56310742 missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56312917 missense probably benign
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56318089 missense probably damaging 1.00
R2329:Uhrf1 UTSW 17 56310671 splice site probably null
R2331:Uhrf1 UTSW 17 56310671 splice site probably null
R2332:Uhrf1 UTSW 17 56310671 splice site probably null
R3624:Uhrf1 UTSW 17 56317023 missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56318020 missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56309401 missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56310834 missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56315478 missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56320542 splice site probably null
R5186:Uhrf1 UTSW 17 56318340 missense probably damaging 1.00
R5711:Uhrf1 UTSW 17 56320259 missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56309574 missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56320450 missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56315193 missense probably damaging 1.00
R7875:Uhrf1 UTSW 17 56312884 missense possibly damaging 0.46
R8540:Uhrf1 UTSW 17 56305105 missense probably damaging 1.00
R8731:Uhrf1 UTSW 17 56322363 missense probably damaging 1.00
R8897:Uhrf1 UTSW 17 56310817 missense probably damaging 1.00
R9349:Uhrf1 UTSW 17 56310737 missense possibly damaging 0.95
R9681:Uhrf1 UTSW 17 56318083 missense possibly damaging 0.51
R9708:Uhrf1 UTSW 17 56322357 missense probably benign 0.01
R9723:Uhrf1 UTSW 17 56318061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAACCTGTCTGTAGCACAGG -3'
(R):5'- GGCACACTTTCGACATGGTTTG -3'

Sequencing Primer
(F):5'- AGGCCTGCCCAGATGATTTAATC -3'
(R):5'- TCATCATCCTTGCAGAACCGG -3'
Posted On 2019-11-12