Incidental Mutation 'R7693:Zc3h11a'
ID593475
Institutional Source Beutler Lab
Gene Symbol Zc3h11a
Ensembl Gene ENSMUSG00000116275
Gene Name
Synonyms1110003F06Rik, 5730454B08Rik, G630041M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133619871-133661380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133645737 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 55 (M55K)
Ref Sequence ENSEMBL: ENSMUSP00000141255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195067] [ENSMUST00000195424]
Predicted Effect probably damaging
Transcript: ENSMUST00000027736
AA Change: M55K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275
AA Change: M55K

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179598
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191896
AA Change: M55K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976
AA Change: M55K

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193504
AA Change: M55K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976
AA Change: M55K

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000194668
AA Change: M55K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976
AA Change: M55K

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Predicted Effect probably damaging
Transcript: ENSMUST00000195424
AA Change: M55K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976
AA Change: M55K

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Zc3h11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zc3h11a APN 1 133625862 missense probably benign
IGL01961:Zc3h11a APN 1 133627067 missense probably benign 0.12
IGL02005:Zc3h11a APN 1 133622142 missense probably benign
IGL02365:Zc3h11a APN 1 133637413 missense probably benign 0.02
IGL02454:Zc3h11a APN 1 133624516 missense probably benign 0.09
PIT4449001:Zc3h11a UTSW 1 133624611 missense probably benign 0.22
R0180:Zc3h11a UTSW 1 133621611 missense probably benign 0.11
R0965:Zc3h11a UTSW 1 133645803 missense possibly damaging 0.80
R1389:Zc3h11a UTSW 1 133633803 missense probably damaging 0.99
R1607:Zc3h11a UTSW 1 133624687 missense probably benign
R1639:Zc3h11a UTSW 1 133624708 missense probably benign 0.03
R1720:Zc3h11a UTSW 1 133621701 missense probably damaging 0.97
R1728:Zc3h11a UTSW 1 133622154 missense probably benign
R1728:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1729:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1739:Zc3h11a UTSW 1 133622154 missense probably benign
R1739:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1762:Zc3h11a UTSW 1 133622154 missense probably benign
R1762:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1783:Zc3h11a UTSW 1 133622154 missense probably benign
R1783:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1784:Zc3h11a UTSW 1 133622154 missense probably benign
R1784:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1785:Zc3h11a UTSW 1 133622154 missense probably benign
R1785:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R2508:Zc3h11a UTSW 1 133624783 missense probably benign 0.01
R4792:Zc3h11a UTSW 1 133640698 missense probably damaging 0.98
R4901:Zc3h11a UTSW 1 133624711 missense probably benign 0.00
R4932:Zc3h11a UTSW 1 133624612 missense probably benign 0.00
R5135:Zc3h11a UTSW 1 133633789 missense probably benign 0.00
R5186:Zc3h11a UTSW 1 133621674 missense probably damaging 0.99
R5357:Zc3h11a UTSW 1 133623042 missense probably damaging 1.00
R5438:Zc3h11a UTSW 1 133640647 missense probably damaging 1.00
R6149:Zc3h11a UTSW 1 133638875 nonsense probably null
R6268:Zc3h11a UTSW 1 133624557 missense probably benign 0.01
R6385:Zc3h11a UTSW 1 133637454 missense possibly damaging 0.82
R6847:Zc3h11a UTSW 1 133638962 splice site probably null
R7107:Zc3h11a UTSW 1 133638917 missense probably damaging 0.96
R7543:Zc3h11a UTSW 1 133627030 missense possibly damaging 0.49
R7742:Zc3h11a UTSW 1 133637435 missense probably benign 0.01
RF018:Zc3h11a UTSW 1 133627115 missense possibly damaging 0.66
RF020:Zc3h11a UTSW 1 133626997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAAACCTGCATGAGGACAAAAGT -3'
(R):5'- GTTAGGTTCTTGGACACTGTTCT -3'

Sequencing Primer
(F):5'- GCCTCAGCAGGTTAAGGTATTCAAC -3'
(R):5'- TTATGGACATGTGCCACAGTC -3'
Posted On2019-11-12