Incidental Mutation 'R7693:Dusp19'
ID593479
Institutional Source Beutler Lab
Gene Symbol Dusp19
Ensembl Gene ENSMUSG00000027001
Gene Namedual specificity phosphatase 19
SynonymsSKRP1, TS-DSP1, 5930436K22Rik, C79103
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location80617045-80632361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80617561 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 60 (T60A)
Ref Sequence ENSEMBL: ENSMUSP00000028384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028384]
Predicted Effect probably benign
Transcript: ENSMUST00000028384
AA Change: T60A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028384
Gene: ENSMUSG00000027001
AA Change: T60A

DomainStartEndE-ValueType
DSPc 64 202 7.6e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Dusp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dusp19 APN 2 80630925 missense probably damaging 0.97
IGL00584:Dusp19 APN 2 80630782 splice site probably null
IGL01291:Dusp19 APN 2 80624274 missense probably benign 0.01
IGL01592:Dusp19 APN 2 80617481 missense probably damaging 1.00
IGL02808:Dusp19 APN 2 80617471 missense probably benign 0.04
IGL03002:Dusp19 APN 2 80630935 missense probably damaging 1.00
ANU05:Dusp19 UTSW 2 80624274 missense probably benign 0.01
P0033:Dusp19 UTSW 2 80617385 start codon destroyed probably null 1.00
R4815:Dusp19 UTSW 2 80630945 missense probably benign 0.00
R5715:Dusp19 UTSW 2 80630986 missense probably benign 0.43
R8073:Dusp19 UTSW 2 80617484 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCTCATGTAATGCACTCCC -3'
(R):5'- GGCAGACACGTCCCTATTTTG -3'

Sequencing Primer
(F):5'- GCTCATGTAATGCACTCCCTGAAC -3'
(R):5'- AGACACGTCCCTATTTTGTTCCTAAC -3'
Posted On2019-11-12