Incidental Mutation 'R7693:Olfr1030'
ID593480
Institutional Source Beutler Lab
Gene Symbol Olfr1030
Ensembl Gene ENSMUSG00000044923
Gene Nameolfactory receptor 1030
SynonymsGA_x6K02T2Q125-47462755-47463693, MOR196-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85979276-85988294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85984635 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 265 (Y265F)
Ref Sequence ENSEMBL: ENSMUSP00000053309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849]
Predicted Effect probably damaging
Transcript: ENSMUST00000056849
AA Change: Y265F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923
AA Change: Y265F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Olfr1030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Olfr1030 APN 2 85984670 missense probably damaging 0.99
IGL01795:Olfr1030 APN 2 85984134 missense probably damaging 1.00
IGL02395:Olfr1030 APN 2 85984082 missense possibly damaging 0.76
IGL03277:Olfr1030 APN 2 85984173 missense probably damaging 0.99
PIT4468001:Olfr1030 UTSW 2 85984448 missense probably benign 0.10
R0458:Olfr1030 UTSW 2 85984256 missense probably benign 0.00
R1114:Olfr1030 UTSW 2 85984307 missense probably benign
R1642:Olfr1030 UTSW 2 85983857 missense probably benign 0.00
R2189:Olfr1030 UTSW 2 85984068 missense probably damaging 1.00
R4094:Olfr1030 UTSW 2 85984218 missense probably damaging 1.00
R4246:Olfr1030 UTSW 2 85984280 missense possibly damaging 0.90
R4677:Olfr1030 UTSW 2 85983971 missense possibly damaging 0.61
R5537:Olfr1030 UTSW 2 85984226 missense possibly damaging 0.83
R6018:Olfr1030 UTSW 2 85984804 utr 3 prime probably benign
R6531:Olfr1030 UTSW 2 85984307 missense probably benign
R7367:Olfr1030 UTSW 2 85984343 missense possibly damaging 0.68
R7611:Olfr1030 UTSW 2 85984063 nonsense probably null
R7753:Olfr1030 UTSW 2 85984716 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAACCACTTCTACTGCGCTG -3'
(R):5'- CAGGATGGTTTTACTTTGAAAGCAC -3'

Sequencing Primer
(F):5'- CTGCTCTGACACATTCATTAAGG -3'
(R):5'- TGAAAGCACATTTCTTCTGACCAGC -3'
Posted On2019-11-12