Incidental Mutation 'R7693:Anapc1'
ID593482
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128641537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1213 (S1213P)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: S1213P

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S1213P

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCAGCCAACAGGACTTCC -3'
(R):5'- TGGCACCGTTCTACTTCAAATG -3'

Sequencing Primer
(F):5'- AACAGGACTTCCGCAGTGTGTC -3'
(R):5'- GCCAGACTACATGATTGTGAGTTTC -3'
Posted On2019-11-12