Incidental Mutation 'R7693:Anapc1'
ID 593482
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms Apc1, tsg24, Mcpr, 2610021O03Rik
MMRRC Submission 045708-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7693 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128452024-128529311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128483457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1213 (S1213P)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: S1213P

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S1213P

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,827,968 (GRCm39) S63I probably damaging Het
Adcy10 A G 1: 165,398,340 (GRCm39) E1479G probably benign Het
Alpl C T 4: 137,471,120 (GRCm39) G339R probably damaging Het
Aoc3 C A 11: 101,223,338 (GRCm39) H525N probably benign Het
Arhgap33 A T 7: 30,225,537 (GRCm39) probably null Het
Arhgef4 A G 1: 34,763,222 (GRCm39) E826G probably benign Het
Art2a A T 7: 101,204,056 (GRCm39) *161R probably null Het
Azi2 A T 9: 117,876,661 (GRCm39) N59I probably damaging Het
Cdhr5 T C 7: 140,851,691 (GRCm39) T538A probably benign Het
Cilk1 A G 9: 78,065,008 (GRCm39) D306G probably benign Het
Csnk2b C A 17: 35,336,972 (GRCm39) G123C probably null Het
Dnaaf10 T C 11: 17,162,064 (GRCm39) V34A probably benign Het
Dnaja2 G T 8: 86,266,939 (GRCm39) P306Q probably damaging Het
Dusp19 A G 2: 80,447,905 (GRCm39) T60A probably benign Het
Epm2aip1 G A 9: 111,101,443 (GRCm39) G139S probably benign Het
Fer1l4 A G 2: 155,862,351 (GRCm39) F1774S possibly damaging Het
Fxyd3 T A 7: 30,770,598 (GRCm39) R66S probably benign Het
Gjd2 T C 2: 113,842,309 (GRCm39) N56S probably damaging Het
Gmcl1 A G 6: 86,691,239 (GRCm39) I252T probably benign Het
Gnl1 T C 17: 36,299,112 (GRCm39) C517R probably damaging Het
Grin1 T A 2: 25,208,679 (GRCm39) M74L possibly damaging Het
Hinfp A G 9: 44,209,642 (GRCm39) M244T probably damaging Het
Iqca1l T C 5: 24,751,626 (GRCm39) I541V probably benign Het
Kcnma1 T A 14: 23,417,680 (GRCm39) I850F probably damaging Het
Kif13a G T 13: 46,904,089 (GRCm39) T1748N probably benign Het
Lama1 C T 17: 68,124,026 (GRCm39) A2817V Het
Map6 C T 7: 98,985,499 (GRCm39) L671F possibly damaging Het
Neb C T 2: 52,189,581 (GRCm39) A770T probably damaging Het
Noc2l T A 4: 156,324,764 (GRCm39) H280Q probably damaging Het
Ntrk1 T C 3: 87,695,733 (GRCm39) D205G probably benign Het
Or5m5 A T 2: 85,814,979 (GRCm39) Y265F probably damaging Het
Or7a37 A T 10: 78,806,137 (GRCm39) Y218F probably damaging Het
Parp9 A G 16: 35,777,282 (GRCm39) S409G possibly damaging Het
Pcnx2 G A 8: 126,613,864 (GRCm39) T529I probably benign Het
Popdc3 A G 10: 45,191,227 (GRCm39) S113G probably benign Het
Rbm8a T C 3: 96,537,624 (GRCm39) I25T probably damaging Het
Rfc4 A G 16: 22,946,163 (GRCm39) W40R probably damaging Het
Rp1 T C 1: 4,417,626 (GRCm39) D1162G probably damaging Het
Slc14a2 G A 18: 78,197,218 (GRCm39) A846V possibly damaging Het
Spx A G 6: 142,360,516 (GRCm39) D56G probably damaging Het
Tanc2 T A 11: 105,814,293 (GRCm39) N1912K probably damaging Het
Tmcc1 T C 6: 116,001,843 (GRCm39) I559V Het
Tnfaip3 A G 10: 18,880,528 (GRCm39) V513A probably benign Het
Ucp3 T C 7: 100,131,799 (GRCm39) F217L probably benign Het
Zc3h11a A T 1: 133,573,475 (GRCm39) M55K probably damaging Het
Zfp316 G A 5: 143,249,167 (GRCm39) T156I unknown Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128,487,050 (GRCm39) splice site probably benign
IGL00704:Anapc1 APN 2 128,505,904 (GRCm39) missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128,471,649 (GRCm39) missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128,475,328 (GRCm39) missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128,495,090 (GRCm39) missense probably benign
IGL02089:Anapc1 APN 2 128,505,853 (GRCm39) missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128,501,772 (GRCm39) missense probably benign
IGL02570:Anapc1 APN 2 128,487,120 (GRCm39) missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128,465,851 (GRCm39) missense probably benign 0.02
IGL02726:Anapc1 APN 2 128,501,705 (GRCm39) missense probably benign 0.05
IGL03265:Anapc1 APN 2 128,469,117 (GRCm39) missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128,469,033 (GRCm39) splice site probably benign
IGL03327:Anapc1 APN 2 128,465,854 (GRCm39) missense probably benign 0.00
R0023:Anapc1 UTSW 2 128,520,138 (GRCm39) missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128,465,886 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128,476,631 (GRCm39) missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128,483,260 (GRCm39) critical splice donor site probably null
R0467:Anapc1 UTSW 2 128,510,963 (GRCm39) missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128,474,575 (GRCm39) missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128,461,252 (GRCm39) missense probably benign 0.17
R0919:Anapc1 UTSW 2 128,459,651 (GRCm39) missense probably benign
R1175:Anapc1 UTSW 2 128,522,108 (GRCm39) missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128,459,617 (GRCm39) missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128,459,476 (GRCm39) missense probably benign 0.44
R1556:Anapc1 UTSW 2 128,466,819 (GRCm39) missense probably benign 0.00
R1567:Anapc1 UTSW 2 128,459,636 (GRCm39) missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128,470,452 (GRCm39) missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128,500,166 (GRCm39) critical splice donor site probably null
R1677:Anapc1 UTSW 2 128,518,128 (GRCm39) missense probably benign 0.09
R1854:Anapc1 UTSW 2 128,517,810 (GRCm39) missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128,501,708 (GRCm39) missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128,475,335 (GRCm39) missense probably benign 0.36
R1984:Anapc1 UTSW 2 128,511,608 (GRCm39) missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128,490,378 (GRCm39) missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128,484,468 (GRCm39) missense probably benign 0.23
R2928:Anapc1 UTSW 2 128,522,057 (GRCm39) missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128,484,602 (GRCm39) missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128,484,439 (GRCm39) missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128,469,149 (GRCm39) intron probably benign
R4359:Anapc1 UTSW 2 128,465,476 (GRCm39) missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128,518,169 (GRCm39) critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128,469,115 (GRCm39) missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128,505,925 (GRCm39) missense probably benign 0.05
R4770:Anapc1 UTSW 2 128,527,980 (GRCm39) splice site probably benign
R4824:Anapc1 UTSW 2 128,470,610 (GRCm39) missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128,526,514 (GRCm39) missense probably benign 0.23
R5016:Anapc1 UTSW 2 128,449,095 (GRCm39) unclassified probably benign
R5063:Anapc1 UTSW 2 128,471,469 (GRCm39) missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128,501,837 (GRCm39) missense probably benign
R5271:Anapc1 UTSW 2 128,527,905 (GRCm39) nonsense probably null
R5363:Anapc1 UTSW 2 128,492,114 (GRCm39) critical splice donor site probably null
R5469:Anapc1 UTSW 2 128,517,621 (GRCm39) nonsense probably null
R5473:Anapc1 UTSW 2 128,449,115 (GRCm39) unclassified probably benign
R5559:Anapc1 UTSW 2 128,522,354 (GRCm39) nonsense probably null
R5631:Anapc1 UTSW 2 128,499,137 (GRCm39) missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128,466,836 (GRCm39) missense probably benign 0.19
R5840:Anapc1 UTSW 2 128,448,957 (GRCm39) unclassified probably benign
R6226:Anapc1 UTSW 2 128,492,292 (GRCm39) missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128,514,055 (GRCm39) nonsense probably null
R6561:Anapc1 UTSW 2 128,505,919 (GRCm39) missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128,526,454 (GRCm39) nonsense probably null
R6799:Anapc1 UTSW 2 128,501,657 (GRCm39) missense probably null 0.38
R6887:Anapc1 UTSW 2 128,501,688 (GRCm39) missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128,511,820 (GRCm39) missense probably benign 0.06
R7011:Anapc1 UTSW 2 128,490,601 (GRCm39) splice site probably null
R7041:Anapc1 UTSW 2 128,470,576 (GRCm39) missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128,457,350 (GRCm39) missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128,520,194 (GRCm39) missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128,516,522 (GRCm39) missense probably benign 0.33
R7123:Anapc1 UTSW 2 128,454,930 (GRCm39) missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128,516,604 (GRCm39) missense probably damaging 0.96
R7839:Anapc1 UTSW 2 128,526,528 (GRCm39) missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128,511,828 (GRCm39) missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128,516,513 (GRCm39) missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128,490,408 (GRCm39) missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128,474,547 (GRCm39) missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128,461,837 (GRCm39) nonsense probably null
R8402:Anapc1 UTSW 2 128,472,148 (GRCm39) missense probably benign 0.02
R8422:Anapc1 UTSW 2 128,517,757 (GRCm39) missense probably benign
R8425:Anapc1 UTSW 2 128,511,788 (GRCm39) missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128,500,264 (GRCm39) splice site probably null
R8553:Anapc1 UTSW 2 128,461,833 (GRCm39) missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128,527,748 (GRCm39) missense probably benign 0.19
R8699:Anapc1 UTSW 2 128,483,373 (GRCm39) missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128,483,369 (GRCm39) missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128,464,333 (GRCm39) missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128,505,952 (GRCm39) missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128,483,322 (GRCm39) missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128,476,628 (GRCm39) missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128,464,426 (GRCm39) missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128,465,422 (GRCm39) missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128,464,420 (GRCm39) missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128,459,642 (GRCm39) missense probably benign 0.08
R9415:Anapc1 UTSW 2 128,476,598 (GRCm39) missense probably benign
R9436:Anapc1 UTSW 2 128,518,045 (GRCm39) missense probably benign
R9516:Anapc1 UTSW 2 128,517,633 (GRCm39) missense possibly damaging 0.77
R9563:Anapc1 UTSW 2 128,505,980 (GRCm39) nonsense probably null
R9572:Anapc1 UTSW 2 128,505,976 (GRCm39) missense probably benign
R9757:Anapc1 UTSW 2 128,517,676 (GRCm39) missense probably damaging 1.00
R9766:Anapc1 UTSW 2 128,500,221 (GRCm39) missense probably damaging 1.00
X0066:Anapc1 UTSW 2 128,516,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCAGCCAACAGGACTTCC -3'
(R):5'- TGGCACCGTTCTACTTCAAATG -3'

Sequencing Primer
(F):5'- AACAGGACTTCCGCAGTGTGTC -3'
(R):5'- GCCAGACTACATGATTGTGAGTTTC -3'
Posted On 2019-11-12