Incidental Mutation 'R7693:Ntrk1'
ID593484
Institutional Source Beutler Lab
Gene Symbol Ntrk1
Ensembl Gene ENSMUSG00000028072
Gene Nameneurotrophic tyrosine kinase, receptor, type 1
SynonymsTkr, TrkA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location87778244-87795162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87788426 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 205 (D205G)
Ref Sequence ENSEMBL: ENSMUSP00000029712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029712] [ENSMUST00000029714] [ENSMUST00000090981]
Predicted Effect probably benign
Transcript: ENSMUST00000029712
AA Change: D205G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029712
Gene: ENSMUSG00000028072
AA Change: D205G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LRR_8 91 150 8.9e-14 PFAM
Pfam:TPKR_C2 151 194 4.9e-15 PFAM
IG 202 285 3.2e-2 SMART
low complexity region 419 442 N/A INTRINSIC
TyrKc 513 784 2.31e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in premature death due to severe sensory and sympathetic neuropathies. A conditional mutant mouse exhibits defects in mast cell and B cell physiology. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Ntrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ntrk1 APN 3 87791438 missense possibly damaging 0.94
IGL00756:Ntrk1 APN 3 87783697 missense probably benign 0.05
IGL01340:Ntrk1 APN 3 87788714 missense possibly damaging 0.72
IGL02262:Ntrk1 APN 3 87781797 missense probably damaging 1.00
IGL02268:Ntrk1 APN 3 87781531 missense probably damaging 1.00
IGL02290:Ntrk1 APN 3 87781771 missense probably benign 0.11
IGL02435:Ntrk1 APN 3 87788732 missense probably benign 0.01
IGL03007:Ntrk1 APN 3 87782743 missense possibly damaging 0.56
PIT4802001:Ntrk1 UTSW 3 87788634 missense probably damaging 0.98
R0015:Ntrk1 UTSW 3 87791750 intron probably benign
R0140:Ntrk1 UTSW 3 87778568 missense probably damaging 1.00
R0269:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R0457:Ntrk1 UTSW 3 87791707 missense probably benign
R0617:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R1144:Ntrk1 UTSW 3 87781542 missense probably damaging 1.00
R1152:Ntrk1 UTSW 3 87778593 missense probably benign 0.33
R1439:Ntrk1 UTSW 3 87789611 splice site probably null
R1588:Ntrk1 UTSW 3 87780077 nonsense probably null
R1764:Ntrk1 UTSW 3 87780084 missense probably damaging 0.99
R1766:Ntrk1 UTSW 3 87778518 missense probably damaging 1.00
R1771:Ntrk1 UTSW 3 87789630 missense probably benign
R2264:Ntrk1 UTSW 3 87779634 critical splice donor site probably null
R2377:Ntrk1 UTSW 3 87791407 missense possibly damaging 0.70
R4059:Ntrk1 UTSW 3 87781479 missense probably damaging 1.00
R4950:Ntrk1 UTSW 3 87789611 splice site probably null
R5107:Ntrk1 UTSW 3 87794973 missense probably benign 0.01
R5805:Ntrk1 UTSW 3 87780172 missense probably damaging 1.00
R6073:Ntrk1 UTSW 3 87791370 splice site probably null
R6372:Ntrk1 UTSW 3 87786048 missense probably benign
R6894:Ntrk1 UTSW 3 87782802 missense probably damaging 1.00
R6972:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R6973:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R7309:Ntrk1 UTSW 3 87795077 missense probably benign 0.00
R7836:Ntrk1 UTSW 3 87779734 nonsense probably null
R8311:Ntrk1 UTSW 3 87781563 missense probably damaging 1.00
R8458:Ntrk1 UTSW 3 87791669 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCTGAGCCATCTCTGTC -3'
(R):5'- AGACGCTTCATGACTCTGGG -3'

Sequencing Primer
(F):5'- GAGCCATCTCTGTCCTTCCAG -3'
(R):5'- CTTCATGACTCTGGGCCTGGAG -3'
Posted On2019-11-12