Incidental Mutation 'R7693:Rbm8a'
ID593485
Institutional Source Beutler Lab
Gene Symbol Rbm8a
Ensembl Gene ENSMUSG00000038374
Gene NameRNA binding motif protein 8a
Synonyms2310057C03Rik, Rbm8
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96629933-96633791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96630308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 25 (I25T)
Ref Sequence ENSEMBL: ENSMUSP00000143190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048915] [ENSMUST00000062058] [ENSMUST00000196456] [ENSMUST00000198027] [ENSMUST00000200647]
Predicted Effect probably damaging
Transcript: ENSMUST00000048915
AA Change: I25T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044548
Gene: ENSMUSG00000038374
AA Change: I25T

DomainStartEndE-ValueType
low complexity region 27 36 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196456
AA Change: I25T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143190
Gene: ENSMUSG00000038374
AA Change: I25T

DomainStartEndE-ValueType
low complexity region 27 36 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198027
AA Change: I36T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143346
Gene: ENSMUSG00000038374
AA Change: I36T

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 38 47 N/A INTRINSIC
RRM 85 158 3.5e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200647
SMART Domains Protein: ENSMUSP00000142699
Gene: ENSMUSG00000038374

DomainStartEndE-ValueType
RRM 25 98 3.5e-24 SMART
low complexity region 103 125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved RNA-binding motif. The protein is found predominantly in the nucleus, although it is also present in the cytoplasm. It is preferentially associated with mRNAs produced by splicing, including both nuclear mRNAs and newly exported cytoplasmic mRNAs. It is thought that the protein remains associated with spliced mRNAs as a tag to indicate where introns had been present, thus coupling pre- and post-mRNA splicing events. Previously, it was thought that two genes encode this protein, RBM8A and RBM8B; it is now thought that the RBM8B locus is a pseudogene. There are two alternate translation start codons with this gene, which result in two forms of the protein. An allele mutation and a low-frequency noncoding single-nucleotide polymorphism (SNP) in this gene cause thrombocytopenia-absent radius (TAR) syndrome. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Rbm8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Rbm8a APN 3 96631537 missense probably damaging 1.00
R1616:Rbm8a UTSW 3 96631730 utr 3 prime probably benign
R4706:Rbm8a UTSW 3 96630052 unclassified probably benign
R5186:Rbm8a UTSW 3 96630932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTTTCCTGGGACGTCACC -3'
(R):5'- CGGGACCCCTCTTCTAAAAG -3'

Sequencing Primer
(F):5'- CTGGGTCTGAAAAGATAGACTCCTC -3'
(R):5'- GGGACCCCTCTTCTAAAAGAATTC -3'
Posted On2019-11-12